Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200472 |
| Name | oriT_ICEPaePA14-1  |
| Organism | Pseudomonas aeruginosa UCBPP-PA14 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | CP000438 (11720..11829 [-], 110 nt) |
| oriT length | 110 nt |
| IRs (inverted repeats) | 72..77, 80..85 (ACCCGC..GCGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 110 nt
>oriT_ICEPaePA14-1
CCGGCAGCCTCGCAGAGCAGGATGCCCCGTTGAGCGCCCCCGGCGCGAATAAGGGGACGTGAAGAAGGACAACCCGCTTGCGGGTGGGCCTACTTCACACATCCTGCCCG
CCGGCAGCCTCGCAGAGCAGGATGCCCCGTTGAGCGCCCCCGGCGCGAATAAGGGGACGTGAAGAAGGACAACCCGCTTGCGGGTGGGCCTACTTCACACATCCTGCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 417 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICEPaePA14-1 | GenBank | CP000438 |
| Element size | 6537648 bp | Coordinate of oriT [Strand] | 11720..11829 [-] |
| Host bacterium | Pseudomonas aeruginosa UCBPP-PA14 | Coordinate of element | 1300805..1327539 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |