Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200457 |
| Name | oriT_Tn916(pAM120)  |
| Organism | Cloning vector pAM120 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | U49939 (2501..2633 [+], 133 nt) |
| oriT length | 133 nt |
| IRs (inverted repeats) | 65..70, 83..88 (AAATCC..GGATTT) 6..12, 23..29 (ACCCCCC..GGGGGGT) |
| Location of nic site | 75..76 |
| Conserved sequence flanking the nic site |
TTTGGTTACA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 133 nt
>oriT_Tn916(pAM120)
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 404 | Element type | ICE (Integrative and conjugative element) |
| Element name | Tn916(pAM120) | GenBank | U49939 |
| Element size | 23363 bp | Coordinate of oriT [Strand] | 2501..2633 [+] |
| Host bacterium | Cloning vector pAM120 | Coordinate of element | 1344..19375 |
Cargo genes
| Drug resistance gene | tet(M) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |