Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200431 |
| Name | oriT_ICEMsp.SymM2A.F.05  |
| Organism | Mesorhizobium sp. M2A.F.Ca.ET.043.05.1.1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | CP034446 (359385..359444 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | 26..34, 36..44 (ACCGCCTCC..GGAGGCGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_ICEMsp.SymM2A.F.05
AAAACGATGTGCAGACAAAGATTTAACCGCCTCCTGGAGGCGGTACCTTTATCTTGCCTT
AAAACGATGTGCAGACAAAGATTTAACCGCCTCCTGGAGGCGGTACCTTTATCTTGCCTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 5833233..5842284
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| EJ069_28035 | 5830684..5832707 | + | 2024 | Protein_5562 | conjugal transfer protein TraG | - |
| EJ069_28040 | 5832824..5833231 | + | 408 | Protein_5563 | CopG family transcriptional regulator | - |
| EJ069_28045 | 5833233..5834201 | + | 969 | AZO18165 | P-type conjugative transfer ATPase TrbB | virB11 |
| EJ069_28050 | 5834214..5834522 | + | 309 | AZO18166 | conjugal transfer protein TrbC | virB2 |
| EJ069_28055 | 5834522..5834794 | + | 273 | AZO18167 | conjugal transfer protein | virB3 |
| EJ069_28060 | 5834788..5837236 | + | 2449 | Protein_5567 | conjugal transfer protein TrbE | - |
| EJ069_28065 | 5837233..5837958 | + | 726 | AZO18168 | P-type conjugative transfer protein TrbJ | virB5 |
| EJ069_28070 | 5837992..5839314 | + | 1323 | AZO18169 | P-type conjugative transfer protein TrbL | virB6 |
| EJ069_28075 | 5839315..5840046 | + | 732 | AZO18170 | conjugal transfer protein TrbF | virB8 |
| EJ069_28080 | 5840036..5841073 | + | 1038 | AZO18171 | P-type conjugative transfer protein TrbG | virB9 |
| EJ069_28085 | 5841070..5842284 | + | 1215 | AZO18172 | TrbI/VirB10 family protein | virB10 |
| EJ069_28090 | 5842297..5842539 | + | 243 | AZO18173 | DUF2274 domain-containing protein | - |
| EJ069_28095 | 5842775..5844124 | - | 1350 | AZO19261 | oxygen-independent coproporphyrinogen III oxidase | - |
| EJ069_28100 | 5844277..5845020 | + | 744 | AZO18174 | Crp/Fnr family transcriptional regulator | - |
| EJ069_28105 | 5845517..5847136 | + | 1620 | AZO18175 | cytochrome-c oxidase, cbb3-type subunit I | - |
Host bacterium
| ID | 384 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICEMsp.SymM2A.F.05 | GenBank | CP034446 |
| Element size | 6749192 bp | Coordinate of oriT [Strand] | 359385..359444 [-] |
| Host bacterium | Mesorhizobium sp. M2A.F.Ca.ET.043.05.1.1 | Coordinate of element | 5453363..5860950 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | nodF, nodE, nodA, nodB, nodC, nodI, nodJ, nodH, nodD, nifA, fixU, nifZ, nifB, fixX, fixB, fixA, nifW, nifS, nifQ, nifH, nifD, nifK, nifE, nifN, nifX, nopC, nolV, nolU, nolT, nolB, nolW, nolX, fixN, fixO, fixQ, fixP, fixG, fixH, fixI, fixS |
| Anti-CRISPR | - |