Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200389
Name   oriT_ICEShaJpn1 in_silico
Organism   Shewanella halifaxensis 6JANF4-E-4
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   BFBQ01000004 (3518..3816 [+], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      45..50, 52..57  (CAAACG..CGTTTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEShaJpn1
GCTCTGTTTGGCGGCGGATGACCTAGTCAAAAAAATCGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTCGCCAAACGGTTTGTATCTTCATGACGATACGTCGTTTTAGGCGTTTTTAAGTGAAATCGGGCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   346 Element type   ICE (Integrative and conjugative element)
Element name   ICEShaJpn1 GenBank   BFBQ01000004
Element size   348230 bp Coordinate of oriT [Strand]   3518..3816 [+]
Host bacterium   Shewanella halifaxensis 6JANF4-E-4 Coordinate of element   213376..320508

Cargo genes


Drug resistance gene   floR, mph(G), mef(C), sul2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -