Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200388 |
| Name | oriT_ICERcoDSM16469-1  |
| Organism | Riemerella columbina DSM 16469 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | ARFT01000009 (18499..18695 [+], 197 nt) |
| oriT length | 197 nt |
| IRs (inverted repeats) | 10..17, 20..27 (TATGTTCA..TGAACATA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 197 nt
>oriT_ICERcoDSM16469-1
ACGGATTTTTATGTTCACCTGAACATAGCAAGATGTCTTTTCAGCCGCTCAAAATATTTTGAGCAGCCACGAAAAGCACTTGCCCTTGCAGGGGGCGGGCTTTCCCTCCGAAGTCGGGAAGCCTTTCAGAACTGCGGTGCTGTAATCCGAAGCGGCGGCTTATGCCGTCAATCCGCTAAATCCAAAGTAATATGAAA
ACGGATTTTTATGTTCACCTGAACATAGCAAGATGTCTTTTCAGCCGCTCAAAATATTTTGAGCAGCCACGAAAAGCACTTGCCCTTGCAGGGGGCGGGCTTTCCCTCCGAAGTCGGGAAGCCTTTCAGAACTGCGGTGCTGTAATCCGAAGCGGCGGCTTATGCCGTCAATCCGCTAAATCCAAAGTAATATGAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 345 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICERcoDSM16469-1 | GenBank | ARFT01000009 |
| Element size | 120953 bp | Coordinate of oriT [Strand] | 18499..18695 [+] |
| Host bacterium | Riemerella columbina DSM 16469 | Coordinate of element | 30256..79009 |
Cargo genes
| Drug resistance gene | tet(Q) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |