Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200329 |
| Name | oriT_ICE_SsalN20_rpsI  |
| Organism | Streptococcus salivarius isolate clinical strain from anonymous patient of Nancy Hospital |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | LR793272 (12640..12788 [-], 149 nt) |
| oriT length | 149 nt |
| IRs (inverted repeats) | 111..116, 124..129 (CACTTT..AAAGTG) 102..107, 111..116 (AAAGTG..CACTTT) 9..15, 28..34 (AACCCCC..GGGGGTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 149 nt
>oriT_ICE_SsalN20_rpsI
GAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATTAAAAGGAG
GAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATTAAAAGGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 294 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICE_SsalN20_rpsI | GenBank | LR793272 |
| Element size | 2170832 bp | Coordinate of oriT [Strand] | 12640..12788 [-] |
| Host bacterium | Streptococcus salivarius isolate clinical strain from anonymous patient of Nancy Hospital | Coordinate of element | 99454..133838 |
Cargo genes
| Drug resistance gene | erm(B), tet(M) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |