Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200326 |
| Name | oriT_ICE_SsalL61_Tn916  |
| Organism | Streptococcus salivarius isolate clinical strain from anonymous patient of Limoges Hospital |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | LR793269 (_) |
| oriT length | 133 nt |
| IRs (inverted repeats) | 6..12, 23..29 (ACCCCCC..GGGGGGT) |
| Location of nic site | 75..76 |
| Conserved sequence flanking the nic site |
TTTGGTTACA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 133 nt
>oriT_ICE_SsalL61_Tn916
ACCTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAATAGCAGAAAATTCTTTGGTTACAAGGAGTTTAGAAAATTTCGTGGTATGTCAAATGAGCTTCAATAGTTGACATAC
ACCTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAATAGCAGAAAATTCTTTGGTTACAAGGAGTTTAGAAAATTTCGTGGTATGTCAAATGAGCTTCAATAGTTGACATAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 291 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICE_SsalL61_fda | GenBank | LR793269 |
| Element size | 2356309 bp | Coordinate of oriT [Strand] | 18424..18562 [+] |
| Host bacterium | Streptococcus salivarius isolate clinical strain from anonymous patient of Limoges Hospital | Coordinate of element | 2234857..2265552 |
Cargo genes
| Drug resistance gene | tet(M) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |