Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 200325 |
Name | oriT_ICE_SsalL61_fda |
Organism | Streptococcus salivarius isolate clinical strain from anonymous patient of Limoges Hospital |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | LR793269 (18424..18562 [+], 139 nt) |
oriT length | 139 nt |
IRs (inverted repeats) | 101..106, 114..119 (CACTTT..AAAGTG) 92..97, 101..106 (AAAGTG..CACTTT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 139 nt
>oriT_ICE_SsalL61_fda
CCCACTATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAG
CCCACTATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 291 | Element type | ICE (Integrative and conjugative element) |
Element name | ICE_SsalL61_fda | GenBank | LR793269 |
Element size | 2356309 bp | Coordinate of oriT [Strand] | 18424..18562 [+] |
Host bacterium | Streptococcus salivarius isolate clinical strain from anonymous patient of Limoges Hospital | Coordinate of element | 2234857..2265552 |
Cargo genes
Drug resistance gene | tet(M) |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |