Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200321 |
| Name | oriT_ICE_SsalL25_fda  |
| Organism | Streptococcus salivarius isolate clinical strain from anonymous patient of Limoges Hospital |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | LR793266 (23883..24021 [+], 139 nt) |
| oriT length | 139 nt |
| IRs (inverted repeats) | 101..106, 114..119 (CACTTT..AAAGTG) 92..97, 101..106 (AAAGTG..CACTTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 139 nt
>oriT_ICE_SsalL25_fda
CCCACTATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAAATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATCAGAAGGAG
CCCACTATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAAATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATCAGAAGGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 287 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICE_SsalL25_fda | GenBank | LR793266 |
| Element size | 2185075 bp | Coordinate of oriT [Strand] | 23883..24021 [+] |
| Host bacterium | Streptococcus salivarius isolate clinical strain from anonymous patient of Limoges Hospital | Coordinate of element | 2043409..2078610 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |