Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200314
Name   oriT_ICE_SsalF1-8_rpmG in_silico
Organism   Streptococcus salivarius isolate commensal strain from anonymous patient (individual 1)
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   LR822045 (14114..14262 [+], 149 nt)
oriT length   149 nt
IRs (inverted repeats)      111..116, 124..129  (CACTTT..AAAGTG)
 102..107, 111..116  (AAAGTG..CACTTT)
 9..15, 28..34  (AACCCCC..GGGGGTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 149 nt

>oriT_ICE_SsalF1-8_rpmG
GAAACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   282 Element type   ICE (Integrative and conjugative element)
Element name   ICE_SsalF1-8_rpmG GenBank   LR822045
Element size   2190275 bp Coordinate of oriT [Strand]   14114..14262 [+]
Host bacterium   Streptococcus salivarius isolate commensal strain from anonymous patient (individual 1) Coordinate of element   2120699..2147970

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -