Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200313 |
| Name | oriT_ICE_SsalF1-4_fda  |
| Organism | Streptococcus salivarius isolate commensal strain from anonymous patient (individual 1) |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | LR797999 (18407..18555 [+], 149 nt) |
| oriT length | 149 nt |
| IRs (inverted repeats) | 111..116, 124..129 (CACTTT..AAAGTG) 102..107, 111..116 (AAAGTG..CACTTT) 9..15, 28..34 (AACCCCC..GGGGGTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 149 nt
>oriT_ICE_SsalF1-4_fda
GAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAG
GAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 281 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICE_SsalF1-4_fda | GenBank | LR797999 |
| Element size | 2214583 bp | Coordinate of oriT [Strand] | 18407..18555 [+] |
| Host bacterium | Streptococcus salivarius isolate commensal strain from anonymous patient (individual 1) | Coordinate of element | 2080530..2110265 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |