Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200312 |
| Name | oriT_ICE_SsalB57_fda |
| Organism | Streptococcus salivarius isolate clinical strain from anonymous patient at Besancon hospital |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | LR793259 (14168..14304 [+], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 111..116, 124..129 (CACTTT..AAAGTG) 102..107, 111..116 (AAAGTG..CACTTT) 9..15, 28..34 (AACCCCC..GGGGGTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_ICE_SsalB57_fda
GAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTT
GAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 280 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICE_SsalB57_fda | GenBank | LR793259 |
| Element size | 2238090 bp | Coordinate of oriT [Strand] | 14168..14304 [+] |
| Host bacterium | Streptococcus salivarius isolate clinical strain from anonymous patient at Besancon hospital | Coordinate of element | 2126294..2152765 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |