Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 200311 |
Name | oriT_ICE_SsalB50_fda |
Organism | Streptococcus salivarius isolate clinical strain from anonymous patient of Besancon hospital |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | LR793256 (14440..14588 [+], 149 nt) |
oriT length | 149 nt |
IRs (inverted repeats) | 111..116, 124..129 (CACTTT..AAAGTG) 102..107, 111..116 (AAAGTG..CACTTT) 9..15, 28..34 (AACCCCC..GGGGGTT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 149 nt
>oriT_ICE_SsalB50_fda
GAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAG
GAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 279 | Element type | ICE (Integrative and conjugative element) |
Element name | ICE_SsalB50_fda | GenBank | LR793256 |
Element size | 2288276 bp | Coordinate of oriT [Strand] | 14440..14588 [+] |
Host bacterium | Streptococcus salivarius isolate clinical strain from anonymous patient of Besancon hospital | Coordinate of element | 2161975..2187845 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |