Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200281 |
| Name | oriT_ICEKpnSCM96-1  |
| Organism | Klebsiella pneumoniae strain SCM96 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | CP028716 (46134..46257 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 40..47, 59..66 (ATTTTTTC..GAAAAAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_ICEKpnSCM96-1
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 258 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICEKpnSCM96-1 | GenBank | CP028716 |
| Element size | 5398745 bp | Coordinate of oriT [Strand] | 46134..46257 [+] |
| Host bacterium | Klebsiella pneumoniae strain SCM96 | Coordinate of element | 4084953..4143152 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |