Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200250 |
| Name | oriT_ICEKpnkpn154-1  |
| Organism | Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | LR745042 (15894..16017 [-], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 40..47, 59..66 (ATTTTTTC..GAAAAAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_ICEKpnkpn154-1
CCGATTAGGCGCGACCAATCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGATTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
CCGATTAGGCGCGACCAATCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGATTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 229 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICEKpnkpn154-1 | GenBank | LR745042 |
| Element size | 5245353 bp | Coordinate of oriT [Strand] | 15894..16017 [-] |
| Host bacterium | Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 | Coordinate of element | 1803028..1865205 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |