Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200247 |
| Name | oriT_ICEKpnKP7-2  |
| Organism | Klebsiella pneumoniae strain KP7 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | CP025088 (46598..46721 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 95..102, 106..113 (GTCGCGCG..CGCGCGAC) 40..47, 59..66 (ATTTTTTC..GAAAAAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_ICEKpnKP7-2
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGCGCGACGGTGTGCCGCC
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGCGCGACGGTGTGCCGCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 226 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICEKpnKP7-2 | GenBank | CP025088 |
| Element size | 5405065 bp | Coordinate of oriT [Strand] | 46598..46721 [+] |
| Host bacterium | Klebsiella pneumoniae strain KP7 | Coordinate of element | 3276885..3375968 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |