Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200157 |
| Name | oriT_ICEKpn4928STDY7387736-1  |
| Organism | Klebsiella variicola strain 4928STDY7387736 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | LR607362 (28201..28323 [-], 123 nt) |
| oriT length | 123 nt |
| IRs (inverted repeats) | 40..47, 58..65 (GTTTTTTC..GAAAAAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 123 nt
>oriT_ICEKpn4928STDY7387736-1
CCGATCAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCGTTTTTTCGAGCCTGCGAGAAAAAACAGGCGAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
CCGATCAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCGTTTTTTCGAGCCTGCGAGAAAAAACAGGCGAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 154 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICEKpn4928STDY7387736-1 | GenBank | LR607362 |
| Element size | 5861889 bp | Coordinate of oriT [Strand] | 28201..28323 [-] |
| Host bacterium | Klebsiella variicola strain 4928STDY7387736 | Coordinate of element | 780300..825052 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |