Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200109
Name   oriT_ICEPmiChn3 in_silico
Organism   Proteus mirabilis integrative and
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   KY437727 (3814..4112 [+], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      234..242, 254..262  (AAAGCCAAA..TTTGGCTTT)
 45..50, 52..57  (CAAACG..CGTTTG)
 7..12, 26..31  (TTTGGC..GCCAAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEPmiChn3
GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTTTTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   111 Element type   ICE (Integrative and conjugative element)
Element name   ICEPmiChn3 GenBank   KY437727
Element size   57013 bp Coordinate of oriT [Strand]   3814..4112 [+]
Host bacterium   Proteus mirabilis integrative and Coordinate of element   1..55195

Cargo genes


Drug resistance gene   floR, sul2, aph(4)-Ia, aac(3)-IVa, dfrA32, ere(A), aadA2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -