Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200089
Name   oriT_MGIVvuTai1 experimental
Organism   Vibrio vulnificus YJ016
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   BA000037 (285176..285455 [+], 280 nt)
oriT length   280 nt
IRs (inverted repeats)      IR1: 177..191, 213..227  (ATCGAGAAGCTAAAC..GTTTGGCGTTTCGAT)
  IR2: 226..240, 249..263  (ATCCAAAAGCCAAAC..GTTTTGGCGTATGGG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   

  oriT sequence  


Download         Length: 280 nt

>oriT_MGIVvuTai1
GCTGTTTGGCGGCATTTAGCCCATGCAAAAAAATCGAGACGCCAAACGATCGTTTGCATTCTGGGTTAGCAAAAACAAACGGTTTGTACTTTGATGCCGAGGTTGGTTTAGGGTGCAAAAAGTGCCAAACCTTGCTTTGATCCAGTACTGGCAAGGCTTAGCAGCGTTGGATTTCAATCGAGAAGCTAAACAGTGAATGGGCTAATTTCCCTGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCGTATGGGGGTAAAGGCATGGGGAA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Daccord A et al. (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PMID:20807202]


Host bacterium


ID   97 Element type   IME (Integrative mobilizable element)
Element name   MGIVvuTai1 GenBank   BA000037
Element size   3354505 bp Coordinate of oriT [Strand]   285176..285455 [+]
Host bacterium   Vibrio vulnificus YJ016 Coordinate of element   270097..289135

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -