Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200087
Name   oriT_MGIVflInd1 experimental
Organism   Vibrio fluvialis strain H-08942
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   KC117176 (5288..5569 [-], 282 nt)
oriT length   282 nt
IRs (inverted repeats)      IR1: 179..193, 215..229  (ATCGAGAAGCCAAGC..GTTTGGCGTTTCGAT)
  IR2: 228..242, 251..265  (ATCCAAAAGCCAAAC..GTTTTGGCGTATGGG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   

  oriT sequence  


Download         Length: 282 nt

>oriT_MGIVflInd1
GTGCTGTTTGGCGGCATTTGGCTAGTGCAAAAAAATCGAGACGCCAAACGATCGTTTGCATTCTGGGTTTAAAAAATCAAACGGTTTGTACTTTGATGCCGAGGTTGGTTTAGGGTACAAAAAGTGCCAAACCTTGCTTTGAGTCAGTAATGGCAAGGCCTACTGGTTTTGGATTTCAATCGAGAAGCCAAGCAGTAAATGGACTAATTTCCCTGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCGTATGGGGGTAAAGGCATGGGGAA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Daccord A et al. (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PMID:20807202]


Host bacterium


ID   95 Element type   IME (Integrative mobilizable element)
Element name   MGIVflInd1 GenBank   KC117176
Element size   23229 bp Coordinate of oriT [Strand]   5288..5569 [-]
Host bacterium   Vibrio fluvialis strain H-08942

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -