Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200086
Name   oriT_MTnSag1 experimental
Organism   Streptococcus agalactiae strain UCN36
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   AY928180 (1488..1667 [+], 180 nt)
oriT length   180 nt
IRs (inverted repeats)      IR1: 6..24, 32..51  (AAGGAAGAATTGAGGAAAT..TCCTGTATTGAACCATATAG)
  IR2: 89..105, 114..129  (AATGATGCACATGATGT..TGTGTGAGACACTTCA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   

  oriT sequence  


Download         Length: 180 nt

>oriT_MTnSag1
GGGTAAAGGAAGAATTGAGGAAATAGAGGTTTCCTGTATTGAACCATATAGTCAAGTAATGTTCCATCTGGGATACGAGTTTGATGAAAATGATGCACATGATGTGAAGTTATTGTGTGAGACACTTCATATCGAAATTCCAAATGAGTATAGATAACTGCAAATAACAGTTTGTAGGGG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Adeline Achard et al. (2007) Characterization of a small mobilizable transposon, MTnSag1, in Streptococcus agalactiae. Journal of bacteriology. 189(11):4328-31. [PMID:17416666]


Host bacterium


ID   94 Element type   IME (Integrative mobilizable element)
Element name   MTnSag1 GenBank   AY928180
Element size   1724 bp Coordinate of oriT [Strand]   1488..1667 [+]
Host bacterium   Streptococcus agalactiae strain UCN36

Cargo genes


Drug resistance gene   lnu(C)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -