Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200085
Name   oriT_tISCpe8 experimental
Organism   Clostridium perfringens
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   FJ589781 (1642..1845 [+], 204 nt)
oriT length   204 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   

  oriT sequence  


Download         Length: 204 nt

>oriT_tISCpe8
GGTGTTGGAAAAATAGGAAATATTATGGTTTCTTGTATAAATGCTAAAAATCAAGTCTTATTTCACTTAGGGTATGAATTTGGAGAAAGTGATATTCATGATGTAAAATTATTATGTAAAGAATTTAACATTCCGATACCTAAAGAATATGAAAATTTTTAAATTAGCGATAATTATAATCTTTAGATTTAATAATATTACTAT

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Dena Lyras et al. (2009) tISCpe8, an IS1595-family lincomycin resistance element located on a conjugative plasmid in Clostridium perfringens. Journal of bacteriology. 191(20):6345-51. [PMID:19684139]


Host bacterium


ID   93 Element type   IME (Integrative mobilizable element)
Element name   tISCpe8 GenBank   FJ589781
Element size   1964 bp Coordinate of oriT [Strand]   1642..1845 [+]
Host bacterium   Clostridium perfringens

Cargo genes


Drug resistance gene   lnu(P)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -