Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200083 |
| Name | oriT_c-oriT(oriT_ICEEfaV583-1)  |
| Organism | Enterococcus faecalis V583 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | AE016830 (1832281..1832323 [+], 43 nt) |
| oriT length | 43 nt |
| IRs (inverted repeats) | 3..12, 25..34 (AGGTGTTAAC..GTTAACACCT) |
| Location of nic site | 37..38 |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 43 nt
>oriT_c-oriT(oriT_ICEEfaV583-1)
CAAGGTGTTAACTTTTTCAAATGAGTTAACACCTATGCAAATT
CAAGGTGTTAACTTTTTCAAATGAGTTAACACCTATGCAAATT
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Mingxi Hua et al. (2022) A chromosome-encoded T4SS independently contributes to horizontal gene transfer in Enterococcus faecalis. Cell reports. 41(6):111609. [PMID:36351400]
Host bacterium
| ID | 91 | Element type | ICE (Integrative and conjugative element) |
| Element name | ICEEfaV583-1 | GenBank | AE016830 |
| Element size | 3218031 bp | Coordinate of oriT [Strand] | 1832281..1832323 [+] |
| Host bacterium | Enterococcus faecalis V583 | Coordinate of element | 2204066..2258320 |
Cargo genes
| Drug resistance gene | VanHBX |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |