Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200082 |
| Name | oriT_SGI  |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | AF261825 (18017..18140 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | IR1: 8..13, 20..25 (CGCGCA..TGCGCG) IR2: 32..43, 49..60 (AAGCCTAGAGCC..GGCTCAAGGCTT) IR3: 70..87, 104..121 (GCTCTACCCCCGTCTCTG..CAGAGACGGGGTGGAGCA) |
| Location of nic site | |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 124 nt
>oriT_SGI
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] János Kiss et al. (2019) Identification and Characterization of oriT and Two Mobilization Genes Required for Conjugative Transfer of Salmonella Genomic Island 1. Frontiers in microbiology. 0.734027778. [PMID:30894848]
Host bacterium
| ID | 90 | Element type | ICE (Integrative and conjugative element) |
| Element name | SGI1 | GenBank | AF261825 |
| Element size | 47723 bp | Coordinate of oriT [Strand] | 18017..18140 [+] |
| Host bacterium | Salmonella enterica subsp. enterica serovar Typhimurium |
Cargo genes
| Drug resistance gene | aadA2, qacE, floR, tet(G), blaCARB-2, sul1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |