Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200078
Name   oriT_ICEVchHai1 in_silico
Organism   Vibrio cholerae strain VC1786ICE
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   JN648379 (5693..5991 [+], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      178..192, 216..230  (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   _

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEVchHai1
GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTTTTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Daccord A et al. (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PMID:20807202]


Host bacterium


ID   86 Element type   
Element name   ICEVchHai1 GenBank   JN648379
Element size   97915 bp Coordinate of oriT [Strand]   5693..5991 [+]
Host bacterium   Vibrio cholerae strain VC1786ICE

Cargo genes


Drug resistance gene   streptomycin and trimethoprim resistance
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -