Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200077 |
| Name | oriT_ICEVchBan8  |
| Organism | Vibrio cholerae O37 strain MZ03 partial |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | JQ345361 (6209..6507 [+], 299 nt) |
| oriT length | 299 nt |
| IRs (inverted repeats) | 178..192, 216..230 (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | _ |
oriT sequence
Download Length: 299 nt
>oriT_ICEVchBan8
GCTCTGTTTGGCGGCGGATGACTGAGCCAAAAAAATCGAGACGCCAAACGTCGTTTGCATTATGGCCTGAACTCGCCAAACGGTTTGTATCATCATGACGATACGTCTTTTTAGGCGTTTTTAAGTGAAATCGGCCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA
GCTCTGTTTGGCGGCGGATGACTGAGCCAAAAAAATCGAGACGCCAAACGTCGTTTGCATTATGGCCTGAACTCGCCAAACGGTTTGTATCATCATGACGATACGTCTTTTTAGGCGTTTTTAAGTGAAATCGGCCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 2755..33206
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| Locus_0 | 178..825 | - | 648 | AFD28992 | putative cI prophage repressor protein | - |
| Locus_1 | 943..1194 | + | 252 | AFD28993 | hypothetical protein | - |
| Locus_2 | 1250..2119 | + | 870 | AFD28994 | hypothetical protein | - |
| Locus_3 | 2106..2768 | + | 663 | AFD28995 | hypothetical protein | - |
| Locus_4 | 2755..3303 | + | 549 | AFD28996 | hypothetical protein | virB1 |
| Locus_5 | 3300..3599 | + | 300 | AFD28997 | hypothetical protein | - |
| Locus_6 | 3596..4129 | + | 534 | AFD28998 | hypothetical protein | - |
| Locus_7 | 4184..4615 | + | 432 | AFD28999 | hypothetical protein | - |
| Locus_8 | 4769..5038 | - | 270 | AFD29000 | hypothetical protein | - |
| Locus_9 | 5041..6015 | - | 975 | AFD29001 | rod shape determination protein | - |
| Locus_10 | 6111..6233 | + | 123 | AFD29002 | hypothetical protein | - |
| Locus_11 | 6480..6923 | + | 444 | AFD29003 | hypothetical protein | - |
| Locus_12 | 7061..7180 | - | 120 | AFD29004 | error-prone, lesion bypass DNA polymerase V | - |
| Locus_13 | 7180..7479 | - | 300 | AFD29005 | error-prone, lesion bypass DNA polymerase V | - |
| Locus_14 | 7448..7897 | - | 450 | AFD29006 | error-prone repair protein | - |
| Locus_15 | 7896..8153 | + | 258 | AFD29007 | hypothetical protein | - |
| Locus_16 | 8935..9408 | - | 474 | AFD29008 | transposase | - |
| Locus_17 | 9756..11906 | + | 2151 | AFD29009 | conjugative transfer protein TraI | - |
| Locus_18 | 11955..13775 | + | 1821 | AFD29010 | IncF plasmid conjugative transfer protein TraD | virb4 |
| Locus_19 | 13785..14345 | + | 561 | AFD29011 | conjugative transfer protein 234 | - |
| Locus_20 | 14332..14967 | + | 636 | AFD29012 | conjugative transfer protein s043 | tfc7 |
| Locus_21 | 14993..15271 | - | 279 | AFD29013 | hypothetical protein | - |
| Locus_22 | 15268..15591 | - | 324 | AFD29014 | hypothetical protein | - |
| Locus_23 | 15605..15736 | - | 132 | AFD29015 | hypothetical protein | - |
| Locus_24 | 15841..16053 | + | 213 | AFD29016 | IncF plasmid conjugative transfer pilus assembly protein TraL | traL |
| Locus_25 | 16050..16676 | + | 627 | AFD29017 | IncF plasmid conjugative transfer pilus assembly protein TraE | traE |
| Locus_26 | 16660..17556 | + | 897 | AFD29018 | IncF plasmid conjugative transfer pilus assembly protein TraK | traK |
| Locus_27 | 17559..18848 | + | 1290 | AFD29019 | IncF plasmid conjugative transfer pilus assembly protein TraB | traB |
| Locus_28 | 18923..19495 | + | 573 | AFD29020 | conjugative transfer protein TraV | traV |
| Locus_29 | 19492..19878 | + | 387 | AFD29021 | conjugative transfer protein TraA | - |
| Locus_30 | 20056..20889 | + | 834 | AFD29022 | Ynd | - |
| Locus_31 | 20882..21820 | + | 939 | AFD29023 | Ync | - |
| Locus_32 | 22004..22147 | + | 144 | AFD29024 | hypothetical protein | - |
| Locus_33 | 22343..22999 | - | 657 | AFD29025 | hypothetical protein | - |
| Locus_34 | 23043..23189 | - | 147 | AFD29026 | hypothetical protein | - |
| Locus_35 | 23431..24123 | + | 693 | AFD29027 | thiol:disulfide | trbB |
| Locus_36 | 24123..26522 | + | 2400 | AFD29028 | IncF plasmid conjugative transfer pilus assembly protein TraC | virb4 |
| Locus_37 | 26515..26862 | + | 348 | AFD29029 | conjugative transfer protein 345 | - |
| Locus_38 | 26846..27358 | + | 513 | AFD29030 | conjugative signal peptidase | - |
| Locus_39 | 27369..28493 | + | 1125 | AFD29031 | IncF plasmid conjugative transfer pilus assembly protein TraW | traW |
| Locus_40 | 28525..29505 | + | 981 | AFD29032 | IncF plasmid conjugative transfer pilus assembly protein TraU | traU |
| Locus_41 | 29508..33206 | + | 3699 | AFD29033 | IncF plasmid conjugative transfer protein TraN | traN |
| Locus_42 | 33384..34559 | + | 1176 | AFD29034 | FOG: TPR repeat protein | - |
| Locus_43 | 34573..35418 | + | 846 | AFD29035 | outer membrane lipoprotein A precursor | - |
| Locus_44 | 35745..35894 | + | 150 | AFD29036 | hypothetical protein | - |
| Locus_45 | 36729..36896 | + | 168 | AFD29037 | ABC transporter, periplasmic substrate-binding protein | - |
| Locus_46 | 36928..37185 | + | 258 | AFD29038 | hypothetical protein | - |
| Locus_47 | 37230..37883 | + | 654 | AFD29039 | transposase and inactivated derivative | - |
Host bacterium
| ID | 85 | Element type | |
| Element name | ICEVchBan8 | GenBank | JQ345361 |
| Element size | 103382 bp | Coordinate of oriT [Strand] | 6209..6507 [+] |
| Host bacterium | Vibrio cholerae O37 strain MZ03 partial |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |