Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 200073
• Name: oriT_ICEPalBan1
• Organism: Providencia alcalifaciens Ban1 integrating
• Sequence Completeness: intact
• NCBI accession of oriT (coordinates [strand]): GQ463139 (5729..6027 [+], 299 nt)
• oriT length: 299 nt
• IRs (inverted repeats): 178..192, 216..230 (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: _

oriT sequence

• Length: 299 nt

>oriT_ICEPalBan1
GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTTTTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]

T4SS

T4SS were predicted by using oriTfinder2.

Region 1: 41579..61346

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
ICEPALBAN1_0037	37360..38550	+	1191	ACV96093	conserved hypothetical protein	-
ICEPALBAN1_0038	38551..39264	+	714	ACV96039	conserved hypothetical protein	-
ICEPALBAN1_0039	39381..41531	+	2151	ACV96076	conjugative relaxase	-
ICEPALBAN1_0040	41579..43399	+	1821	ACV96062	conjugative coupling factor	virb4
ICEPALBAN1_0041	43409..43969	+	561	ACV96043	conserved hypothetical protein	-
ICEPALBAN1_0042	43956..44591	+	636	ACV96038	putative conjugation coupling factor	tfc7
ICEPALBAN1_0043	44617..44895	-	279	ACV96030	transcriptional regulator, XRE family	-
ICEPALBAN1_0044	44892..45215	-	324	ACV96049	conserved hypothetical protein	-
ICEPALBAN1_0045	45396..45677	+	282	ACV96125	type IV conjugative transfer system protein TraL	traL
ICEPALBAN1_0046	45674..46300	+	627	ACV96057	sex pilus assembly	traE
ICEPALBAN1_0047	46284..47180	+	897	ACV96055	TraK	traK
ICEPALBAN1_0048	47183..48472	+	1290	ACV96119	sex pilus assembly	traB
ICEPALBAN1_0049	48547..49119	+	573	ACV96060	sex pilus assembly	traV
ICEPALBAN1_0050	49116..49502	+	387	ACV96085	TraA	-
ICEPALBAN1_0051	49573..50514	+	942	ACV96035	conserved hypothetical protein	-
ICEPALBAN1_0052	50507..51445	+	939	ACV96032	ync	-
ICEPALBAN1_0053	51577..52269	+	693	ACV96054	DsbC	trbB
ICEPALBAN1_0054	52269..54668	+	2400	ACV96048	type-IV secretion system protein TraC	virb4
ICEPALBAN1_0055	54661..55008	+	348	ACV96113	conserved hypothetical protein	-
ICEPALBAN1_0056	54992..55504	+	513	ACV96114	conjugation signal peptidase	-
ICEPALBAN1_0057	55515..56639	+	1125	ACV96094	sex pilus assembly	traW
ICEPALBAN1_0058	56623..57651	+	1029	ACV96120	sex pilus assembly	traU
ICEPALBAN1_0059	57654..61346	+	3693	ACV96078	mating pair stabilization	traN
ICEPALBAN1_0060	61571..62995	-	1425	ACV96064	transcriptional regulator containing a DNA-binding HTH domain and an aminotransferase domain	-
ICEPALBAN1_0061	63035..63175	-	141	ACV96115	hypothetical protein	-
ICEPALBAN1_0062	63190..64068	+	879	ACV96121	phenazine biosynthesis protein PhzF family	-
ICEPALBAN1_0063	64041..65036	+	996	ACV96075	protein of unknown function DUF6, transmembrane	-
ICEPALBAN1_0064	65033..65428	+	396	ACV96051	endoribonuclease L-PSP, putative	-
ICEPALBAN1_0065	65453..65914	+	462	ACV96116	YbaK/prolyl-tRNA synthetase associated region	-

Host bacterium

• ID: 81
• Element name: ICEPalBan1
• GenBank: GQ463139
• Element size: 96676 bp
• Coordinate of oriT [Strand]: 5729..6027 [+]
• Host bacterium: Providencia alcalifaciens Ban1 integrating

Cargo genes

• Drug resistance gene: floR, aph(6)-Id, aph(3'')-Ib, sul2, dfrA1
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -