Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 200072
• Name: oriT_ICEVflInd1
• Organism: Vibrio fluvialis Ind1 integrating
• Sequence Completeness: intact
• NCBI accession of oriT (coordinates [strand]): GQ463144 (20965..21263 [+], 299 nt)
• oriT length: 299 nt
• IRs (inverted repeats): 178..192, 216..230 (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: _

oriT sequence

• Length: 299 nt

>oriT_ICEVflInd1
GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTTTTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Daccord A et al. (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PMID:20807202]
[2] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]

T4SS

T4SS were predicted by using oriTfinder2.

Region 1: 51768..73275

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
ICEVFLIND1_0054	47383..48552	+	1170	ACV96514	restriction modification system DNA specificity domain	-
ICEVFLIND1_0055	48563..49720	+	1158	ACV96586	conserved hypothetical protein	-
ICEVFLIND1_0058	51591..51719	+	129	ACV96593	conjugative relaxase	-
ICEVFLIND1_0059	51768..53153	+	1386	ACV96547	conjugative coupling factor	virb4
ICEVFLIND1_0060	53304..53420	+	117	ACV96529	hypothetical protein	-
ICEVFLIND1_0061	53436..54953	+	1518	ACV96587	putative transposase for insertion sequence	-
ICEVFLIND1_0062	54977..55672	+	696	ACV96594	conserved hypothetical protein	-
ICEVFLIND1_0063	55733..56443	+	711	ACV96542	transposition helper protein	virB11
ICEVFLIND1_0064	56480..57043	-	564	ACV96517	conserved hypothetical protein	-
ICEVFLIND1_0065	57332..57613	+	282	ACV96589	type IV conjugative transfer system protein TraL	traL
ICEVFLIND1_0066	57610..58236	+	627	ACV96567	sex pilus assembly	traE
ICEVFLIND1_0067	58220..59116	+	897	ACV96549	TraK	traK
ICEVFLIND1_0070	60491..61051	+	561	ACV96511	sex pilus assembly	traV
ICEVFLIND1_0071	61048..61434	+	387	ACV96541	putative pilin subunit	-
ICEVFLIND1_0072	61612..62445	+	834	ACV96573	conserved hypothetical protein	-
ICEVFLIND1_0075	63506..64198	+	693	ACV96525	DsbC	trbB
ICEVFLIND1_0076	64198..66597	+	2400	ACV96552	type-IV secretion system protein TraC	virb4
ICEVFLIND1_0077	66656..66937	+	282	ACV96504	conserved hypothetical protein	-
ICEVFLIND1_0078	66921..67433	+	513	ACV96568	conjugation signal peptidase	-
ICEVFLIND1_0079	67444..68568	+	1125	ACV96595	sex pilus assembly	traW
ICEVFLIND1_0080	68546..69580	+	1035	ACV96559	conjugal transfer protein TraU, putative	traU
ICEVFLIND1_0081	69583..73275	+	3693	ACV96562	mating pair stabilization	traN
ICEVFLIND1_0082	73506..73838	+	333	ACV96566	hypothetical protein	-
ICEVFLIND1_0083	73869..74531	+	663	ACV96578	conserved hypothetical protein	-
ICEVFLIND1_0084	74622..75224	-	603	ACV96561	conserved hypothetical protein	-
ICEVFLIND1_0085	75634..75918	+	285	ACV96590	conserved hypothetical protein	-
ICEVFLIND1_0086	75934..76353	+	420	ACV96585	single-strand binding protein family	-
ICEVFLIND1_0087	76433..77251	+	819	ACV96540	phage recombination protein Bet	-
ICEVFLIND1_0088	77333..77476	+	144	ACV96516	hypothetical protein	-

Host bacterium

• ID: 80
• Element name: ICEVflInd1
• GenBank: GQ463144
• Element size: 114195 bp
• Coordinate of oriT [Strand]: 20965..21263 [+]
• Host bacterium: Vibrio fluvialis Ind1 integrating

Cargo genes

• Drug resistance gene: dfrA18, floR, aph(6)-Id, aph(3'')-Ib, sul2
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -