Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   200068
Name   oriT_ICEVchMex1 in_silico
Organism   Vibrio cholerae Mex1 integrating
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   GQ463143 (5510..5808 [+], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      178..192, 216..230  (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site    		  _
Note   _

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEVchMex1
GCTCTGTTTGGCGGCGGATGACCTAGTCAAAAAAATCGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTCGCCAAACGGTTTGTATCTTCATGACGATACGTCGTTTTAGGCGTTTTTAAGTTAAATCGGGCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]


T4SS

T4SS were predicted by using oriTfinder2.

Region 1: 21698..43341

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
ICEVCHMEX1_0020 19499..21649 + 2151 ACV96483 conjugative relaxase -
ICEVCHMEX1_0021 21698..23518 + 1821 ACV96430 conjugative coupling factor virb4
ICEVCHMEX1_0022 23528..24088 + 561 ACV96474 conserved hypothetical protein -
ICEVCHMEX1_0023 24075..24710 + 636 ACV96470 putative conjugation coupling factor tfc7
ICEVCHMEX1_0024 24848..25954 + 1107 ACV96444 filamentation induced by cAMP protein Fic -
ICEVCHMEX1_0025 26144..26425 + 282 ACV96417 type IV conjugative transfer system protein TraL traL
ICEVCHMEX1_0026 26422..27048 + 627 ACV96490 sex pilus assembly traE
ICEVCHMEX1_0027 27032..27931 + 900 ACV96473 TraK traK
ICEVCHMEX1_0028 27931..29220 + 1290 ACV96463 sex pilus assembly traB
ICEVCHMEX1_0029 29295..29867 + 573 ACV96454 sex pilus assembly traV
ICEVCHMEX1_0030 29864..30250 + 387 ACV96429 TraA -
ICEVCHMEX1_0031 30291..30797 - 507 ACV96420 acetyltransferase, gnat family -
ICEVCHMEX1_0032 30788..31054 - 267 ACV96425 conserved hypothetical protein -
ICEVCHMEX1_0033 31209..31634 - 426 ACV96419 conserved hypothetical protein -
ICEVCHMEX1_0035 32567..33361 + 795 ACV96475 aminoglycoside 3'-phosphotransferase -
ICEVCHMEX1_0036 33571..34263 + 693 ACV96465 DsbC trbB
ICEVCHMEX1_0037 34264..36663 + 2400 ACV96422 type-IV secretion system protein TraC virb4
ICEVCHMEX1_0038 36656..37003 + 348 ACV96452 conserved hypothetical protein -
ICEVCHMEX1_0039 36987..37499 + 513 ACV96439 conjugation signal peptidase -
ICEVCHMEX1_0041 38618..39646 + 1029 ACV96421 sex pilus assembly traU
ICEVCHMEX1_0042 39649..43341 + 3693 ACV96413 mating pair stabilization traN
ICEVCHMEX1_0044 43354..43497 + 144 ACV96489 hypothetical protein -
ICEVCHMEX1_0043 43483..45159 - 1677 ACV96427 UvrD/REP helicase -
ICEVCHMEX1_0045 45156..47081 - 1926 ACV96434 ATP-dependent endonuclease of the OLD family -

Host bacterium

ID   76 Element type   
Element name   ICEVchMex1 GenBank   GQ463143
Element size   83194 bp Coordinate of oriT [Strand]   5510..5808 [+]
Host bacterium   Vibrio cholerae Mex1 integrating

Cargo genes

Drug resistance gene   aph(3')-IIa
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -