Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 200066
• Name: oriT_ICEVchInd4
• Organism: Vibrio cholerae Ind4 integrating
• Sequence Completeness: intact
• NCBI accession of oriT (coordinates [strand]): GQ463141 (3313..3611 [+], 299 nt)
• oriT length: 299 nt
• IRs (inverted repeats): 178..192, 216..230 (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: _

oriT sequence

• Length: 299 nt

>oriT_ICEVchInd4
GCTCTGTTTGGCGGCGGATGACCTAGTCAAAAAAATCGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTCGCCAAACGGTTTGTATCTTCATGACGATACGTCGTTTTAGGCGTTTTTAAGTGAAATCGGGCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]

T4SS

T4SS were predicted by using oriTfinder2.

Region 1: 43185..62958

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
ICEVCHIND4_0034	40986..43136	+	2151	ACV96234	conjugative relaxase	-
ICEVCHIND4_0035	43185..45005	+	1821	ACV96299	conjugative coupling factor	virb4
ICEVCHIND4_0036	45015..45575	+	561	ACV96300	conserved hypothetical protein	-
ICEVCHIND4_0037	45562..46197	+	636	ACV96286	putative conjugation coupling factor	tfc7
ICEVCHIND4_0038	46223..46501	-	279	ACV96237	transcriptional regulator, XRE family	-
ICEVCHIND4_0039	46498..46821	-	324	ACV96271	conserved hypothetical protein	-
ICEVCHIND4_0040	47002..47283	+	282	ACV96257	type IV conjugative transfer system protein TraL	traL
ICEVCHIND4_0041	47280..47906	+	627	ACV96239	sex pilus assembly	traE
ICEVCHIND4_0042	47890..48786	+	897	ACV96236	TraK	traK
ICEVCHIND4_0043	48789..50078	+	1290	ACV96228	sex pilus assembly	traB
ICEVCHIND4_0044	50075..50725	+	651	ACV96244	sex pilus assembly	traV
ICEVCHIND4_0045	50722..51108	+	387	ACV96315	TraA	-
ICEVCHIND4_0046	51179..52120	+	942	ACV96252	conserved hypothetical protein	-
ICEVCHIND4_0047	52113..53051	+	939	ACV96250	ync	-
ICEVCHIND4_0048	53183..53875	+	693	ACV96310	DsbC	trbB
ICEVCHIND4_0049	53875..56274	+	2400	ACV96255	type-IV secretion system protein TraC	virb4
ICEVCHIND4_0050	56267..56614	+	348	ACV96278	conserved hypothetical protein	-
ICEVCHIND4_0051	56598..57110	+	513	ACV96233	conjugation signal peptidase	-
ICEVCHIND4_0052	57121..58245	+	1125	ACV96230	sex pilus assembly	traW
ICEVCHIND4_0053	58277..59257	+	981	ACV96249	sex pilus assembly	traU
ICEVCHIND4_0054	59260..62958	+	3699	ACV96243	mating pair stabilization	traN
ICEVCHIND4_0055	63051..63731	-	681	ACV96304	hypothetical protein	-
ICEVCHIND4_0056	63738..64823	-	1086	ACV96305	conserved hypothetical protein	-
ICEVCHIND4_0057	64823..65887	-	1065	ACV96287	conserved hypothetical protein	-
ICEVCHIND4_0058	66000..66683	-	684	ACV96311	endonuclease-1 (Endonuclease I) (Endo I)	-
ICEVCHIND4_0059	66816..67418	-	603	ACV96272	conserved hypothetical protein	-
ICEVCHIND4_0060	67655..67786	-	132	ACV96259	hypothetical protein	-

Host bacterium

• ID: 74
• Element name: ICEVchInd4
• GenBank: GQ463141
• Element size: 95326 bp
• Coordinate of oriT [Strand]: 3313..3611 [+]
• Host bacterium: Vibrio cholerae Ind4 integrating

Cargo genes

• Drug resistance gene: floR, aph(6)-Id, aph(3'')-Ib, sul2
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -