Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200065
Name   oriT_ICEVchBan9 in_silico
Organism   Vibrio cholerae MJ-1236
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   CP001485 (3060049..3060347 [-], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      178..192, 216..230  (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   _

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEVchBan9
TTTCTACCAAACCAATTTCCCCATCCAATTAACCCCTAAAGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACGTAAAACTGCCGTCACAATCACTGTTTGGCGTCTCGATATAAATCGACTCGCTCAATCCCATACCCGACAAGGGATACAGGCTGATTTCACTTAAAAACACCTAAAAAGACGTATCGCCATGAAGATACAAACCGTTTGGCAAGTTCAGGCCAGAATGCAAACGACGTTTGGCGTCTCAATTTTTTTGGCTAGGTCACCAGCCGCCAAACAGAGC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]


T4SS


T4SS were predicted by using oriTfinder2.

Region 1: 2962770..3016244

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
VCD_003660 2958347..2959936 - 1590 ACQ61816 peptide chain release factor 3 -
VCD_003661 2960193..2960840 - 648 ACQ61817 HTH-type transcriptional regulator for conjugative element SXT -
VCD_003662 2960958..2961209 + 252 ACQ61818 uncharacterized protein conserved in bacteria prophage-related -
VCD_003663 2961265..2962134 + 870 ACQ61819 hypothetical protein -
VCD_003664 2962055..2962783 + 729 ACQ61820 hypothetical protein -
VCD_003665 2962770..2963318 + 549 ACQ61821 soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains) virB1
VCD_003666 2963315..2963614 + 300 ACQ61822 hypothetical protein -
VCD_003667 2964666..2968235 - 3570 ACQ61823 IncF plasmid conjugative transfer protein TraG traG
VCD_003668 2968239..2969627 - 1389 ACQ61824 IncF plasmid conjugative transfer pilus assembly protein TraH traH
VCD_003669 2969630..2970574 - 945 ACQ61825 IncF plasmid conjugative transfer pilus assembly protein TraF traF
VCD_003670 2970831..2971790 - 960 ACQ61826 integron integrase -
VCD_003671 2972078..2972551 + 474 ACQ61827 dihydrofolate reductase -
VCD_003672 2973754..2974122 + 369 ACQ61828 hypothetical protein -
VCD_003673 2974222..2974923 + 702 ACQ61829 hypothetical protein -
VCD_003674 2975596..2976303 - 708 ACQ61830 hypothetical protein -
VCD_003675 2976393..2977466 - 1074 ACQ61831 hypothetical protein -
VCD_003676 2977557..2977898 - 342 ACQ61832 hypothetical protein -
VCD_003677 2977898..2978395 - 498 ACQ61833 DNA repair protein RadC -
VCD_003678 2978480..2980135 - 1656 ACQ61834 hypothetical protein -
VCD_003679 2980205..2980645 - 441 ACQ61835 hypothetical protein -
VCD_003680 2980707..2981660 - 954 ACQ61836 cobalamine biosynthesis protein -
VCD_003681 2981759..2982529 - 771 ACQ61837 hypothetical protein -
VCD_003682 2982526..2983602 - 1077 ACQ61838 ATPase associated with various cellular activities AAA_5 -
VCD_003683 2983695..2984711 - 1017 ACQ61839 DNA recombination protein -
VCD_003684 2984772..2984915 - 144 ACQ61840 hypothetical protein -
VCD_003685 2984997..2985815 - 819 ACQ61841 hypothetical protein -
VCD_003686 2985895..2986314 - 420 ACQ61842 single-stranded DNA-binding protein -
VCD_003687 2986330..2986668 - 339 ACQ61843 hypothetical protein -
VCD_003688 2987024..2987626 + 603 ACQ61844 hypothetical protein -
VCD_003689 2987717..2988379 - 663 ACQ61845 hypothetical protein -
VCD_003690 2988410..2988883 - 474 ACQ61846 hypothetical protein -
VCD_003691 2988974..2992615 - 3642 ACQ61847 IncF plasmid conjugative transfer protein TraN traN
VCD_003692 2992669..2993703 - 1035 ACQ61848 IncF plasmid conjugative transfer pilus assembly protein TraU traU
VCD_003693 2993681..2994844 - 1164 ACQ61849 hypothetical protein traW
VCD_003694 2994816..2995328 - 513 ACQ61850 signal peptidase I -
VCD_003695 2995312..2995659 - 348 ACQ61851 hypothetical protein -
VCD_003696 2995652..2998069 - 2418 ACQ61852 IncF plasmid conjugative transfer pilus assembly protein TraC virb4
VCD_003697 2998051..2998743 - 693 ACQ61853 thiol:disulfide interchange protein DsbC trbB
VCD_003698 2998888..3000333 - 1446 ACQ61854 type 4 fimbriae expression regulatory protein pilR -
VCD_003699 3000336..3001871 - 1536 ACQ61855 hypothetical protein -
VCD_003700 3001881..3002990 - 1110 ACQ61856 hypothetical protein -
VCD_003701 3002987..3005716 - 2730 ACQ61857 hypothetical protein -
VCD_003702 3006281..3007231 - 951 ACQ61858 Ync -
VCD_003703 3007212..3008045 - 834 ACQ61859 Ynd -
VCD_003704 3008223..3008609 - 387 ACQ61860 TraA -
VCD_003705 3008606..3009256 - 651 ACQ61861 conjugative transfer protein TraV traV
VCD_003706 3009253..3010545 - 1293 ACQ61862 IncF plasmid conjugative transfer pilus assembly protein TraB traB
VCD_003707 3010542..3011444 - 903 ACQ61863 IncF plasmid conjugative transfer pilus assembly protein TraK traK
VCD_003708 3011425..3012051 - 627 ACQ61864 hypothetical protein traE
VCD_003709 3012048..3012335 - 288 ACQ61865 IncF plasmid conjugative transfer pilus assembly protein TraL traL
VCD_003710 3012585..3013205 + 621 ACQ61866 hypothetical protein -
VCD_003711 3013232..3013876 - 645 ACQ61867 conjugative transfer protein s043 tfc7
VCD_003712 3013854..3014390 - 537 ACQ61868 hypothetical protein -
VCD_003713 3014424..3016244 - 1821 ACQ61869 TraD virb4
VCD_003714 3016293..3018443 - 2151 ACQ61870 TraI -

Region 2: 2988974..3016244

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
VCD_003684 2984772..2984915 - 144 ACQ61840 hypothetical protein -
VCD_003685 2984997..2985815 - 819 ACQ61841 hypothetical protein -
VCD_003686 2985895..2986314 - 420 ACQ61842 single-stranded DNA-binding protein -
VCD_003687 2986330..2986668 - 339 ACQ61843 hypothetical protein -
VCD_003688 2987024..2987626 + 603 ACQ61844 hypothetical protein -
VCD_003689 2987717..2988379 - 663 ACQ61845 hypothetical protein -
VCD_003690 2988410..2988883 - 474 ACQ61846 hypothetical protein -
VCD_003691 2988974..2992615 - 3642 ACQ61847 IncF plasmid conjugative transfer protein TraN traN
VCD_003692 2992669..2993703 - 1035 ACQ61848 IncF plasmid conjugative transfer pilus assembly protein TraU traU
VCD_003693 2993681..2994844 - 1164 ACQ61849 hypothetical protein traW
VCD_003694 2994816..2995328 - 513 ACQ61850 signal peptidase I -
VCD_003695 2995312..2995659 - 348 ACQ61851 hypothetical protein -
VCD_003696 2995652..2998069 - 2418 ACQ61852 IncF plasmid conjugative transfer pilus assembly protein TraC virb4
VCD_003697 2998051..2998743 - 693 ACQ61853 thiol:disulfide interchange protein DsbC trbB
VCD_003698 2998888..3000333 - 1446 ACQ61854 type 4 fimbriae expression regulatory protein pilR -
VCD_003699 3000336..3001871 - 1536 ACQ61855 hypothetical protein -
VCD_003700 3001881..3002990 - 1110 ACQ61856 hypothetical protein -
VCD_003701 3002987..3005716 - 2730 ACQ61857 hypothetical protein -
VCD_003702 3006281..3007231 - 951 ACQ61858 Ync -
VCD_003703 3007212..3008045 - 834 ACQ61859 Ynd -
VCD_003704 3008223..3008609 - 387 ACQ61860 TraA -
VCD_003705 3008606..3009256 - 651 ACQ61861 conjugative transfer protein TraV traV
VCD_003706 3009253..3010545 - 1293 ACQ61862 IncF plasmid conjugative transfer pilus assembly protein TraB traB
VCD_003707 3010542..3011444 - 903 ACQ61863 IncF plasmid conjugative transfer pilus assembly protein TraK traK
VCD_003708 3011425..3012051 - 627 ACQ61864 hypothetical protein traE
VCD_003709 3012048..3012335 - 288 ACQ61865 IncF plasmid conjugative transfer pilus assembly protein TraL traL
VCD_003710 3012585..3013205 + 621 ACQ61866 hypothetical protein -
VCD_003711 3013232..3013876 - 645 ACQ61867 conjugative transfer protein s043 tfc7
VCD_003712 3013854..3014390 - 537 ACQ61868 hypothetical protein -
VCD_003713 3014424..3016244 - 1821 ACQ61869 TraD virb4
VCD_003714 3016293..3018443 - 2151 ACQ61870 TraI -


Host bacterium


ID   73 Element type   
Element name   ICEVchBan9 GenBank   CP001485
Element size   3149584 bp Coordinate of oriT [Strand]   3060049..3060347 [-]
Host bacterium   Vibrio cholerae MJ-1236

Cargo genes


Drug resistance gene   dfrA1, sul2, aph(3'')-Ib, aph(6)-Id, tet(A), floR
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -