Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200064 |
| Name | oriT_ICEVchBan5  |
| Organism | Vibrio cholerae Ban5 integrating |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | GQ463140 (5580..5878 [+], 299 nt) |
| oriT length | 299 nt |
| IRs (inverted repeats) | 178..192, 216..230 (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | _ |
oriT sequence
Download Length: 299 nt
>oriT_ICEVchBan5
GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTTTTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA
GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTTTTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 48265..68130
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ICEVCHBAN5_0039 | 44324..45094 | + | 771 | ACV96176 | conserved hypothetical protein | - |
| ICEVCHBAN5_0041 | 45129..45944 | + | 816 | ACV96142 | conserved hypothetical protein | - |
| ICEVCHBAN5_0040 | 45921..46043 | - | 123 | ACV96161 | hypothetical protein | - |
| ICEVCHBAN5_0042 | 46066..48216 | + | 2151 | ACV96137 | conjugative relaxase | - |
| ICEVCHBAN5_0043 | 48265..50085 | + | 1821 | ACV96129 | conjugative coupling factor | virb4 |
| ICEVCHBAN5_0044 | 50095..50655 | + | 561 | ACV96148 | conserved hypothetical protein | - |
| ICEVCHBAN5_0045 | 50642..51277 | + | 636 | ACV96225 | putative conjugation coupling factor | tfc7 |
| ICEVCHBAN5_0046 | 51304..51891 | - | 588 | ACV96156 | conserved hypothetical protein | - |
| ICEVCHBAN5_0047 | 52180..52461 | + | 282 | ACV96154 | type IV conjugative transfer system protein TraL | traL |
| ICEVCHBAN5_0048 | 52458..53084 | + | 627 | ACV96220 | sex pilus assembly | traE |
| ICEVCHBAN5_0049 | 53068..53964 | + | 897 | ACV96159 | TraK | traK |
| ICEVCHBAN5_0050 | 53967..55256 | + | 1290 | ACV96183 | sex pilus assembly | traB |
| ICEVCHBAN5_0051 | 55331..55903 | + | 573 | ACV96134 | sex pilus assembly | traV |
| ICEVCHBAN5_0052 | 55900..56286 | + | 387 | ACV96131 | TraA | - |
| ICEVCHBAN5_0053 | 56507..57298 | + | 792 | ACV96153 | conserved hypothetical protein | - |
| ICEVCHBAN5_0054 | 57291..58229 | + | 939 | ACV96147 | ync | - |
| ICEVCHBAN5_0055 | 58361..59053 | + | 693 | ACV96214 | DsbC | trbB |
| ICEVCHBAN5_0056 | 59053..61452 | + | 2400 | ACV96215 | type-IV secretion system protein TraC | virb4 |
| ICEVCHBAN5_0057 | 61445..61792 | + | 348 | ACV96194 | conserved hypothetical protein | - |
| ICEVCHBAN5_0058 | 61776..62288 | + | 513 | ACV96221 | conjugation signal peptidase | - |
| ICEVCHBAN5_0060 | 63407..64435 | + | 1029 | ACV96163 | sex pilus assembly | traU |
| ICEVCHBAN5_0061 | 64438..68130 | + | 3693 | ACV96216 | mating pair stabilization | traN |
| ICEVCHBAN5_0062 | 68221..69837 | - | 1617 | ACV96222 | conserved hypothetical protein | - |
| ICEVCHBAN5_0063 | 69917..70672 | - | 756 | ACV96175 | IstB domain protein ATP-binding protein | - |
| ICEVCHBAN5_0064 | 70662..72170 | - | 1509 | ACV96150 | integrase, catalytic region | - |
Host bacterium
| ID | 72 | Element type | |
| Element name | ICEVchBan5 | GenBank | GQ463140 |
| Element size | 102122 bp | Coordinate of oriT [Strand] | 5580..5878 [+] |
| Host bacterium | Vibrio cholerae Ban5 integrating |
Cargo genes
| Drug resistance gene | floR, aph(6)-Id, aph(3'')-Ib, sul2, dfrA1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |