Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200063 |
| Name | oriT_ICEPmiUSA1  |
| Organism | Proteus mirabilis strain HI4320 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | AM942759 (2726938..2727236 [-], 299 nt) |
| oriT length | 299 nt |
| IRs (inverted repeats) | 178..192, 216..230 (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | _ |
oriT sequence
Download Length: 299 nt
>oriT_ICEPmiUSA1
TTTCTACCAAACCAATTTCCCCATCCAATTAACCCCAAAAGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACGTAAAACTGCCGTAACAATCACTGTTTGGCGTCTCGATATAAATCAACTCGCGCAATCCCATACCTGACAAGGGATACAATCCGATTTCACTTAAAAAAGCCTGAAAAGACGTATCGCCATGAAGATACAAACCGTTTGGCGAGTTCAGGCCAGAATGCAAACGACGTTTGGCGTCTCGATTTTTTTGGCTCAGTCATCCGCCGCAAAACAGAGC
TTTCTACCAAACCAATTTCCCCATCCAATTAACCCCAAAAGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACGTAAAACTGCCGTAACAATCACTGTTTGGCGTCTCGATATAAATCAACTCGCGCAATCCCATACCTGACAAGGGATACAATCCGATTTCACTTAAAAAAGCCTGAAAAGACGTATCGCCATGAAGATACAAACCGTTTGGCGAGTTCAGGCCAGAATGCAAACGACGTTTGGCGTCTCGATTTTTTTGGCTCAGTCATCCGCCGCAAAACAGAGC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Daccord A et al. (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PMID:20807202]
[2] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 2682565..2702429
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PMI2451 | 2677804..2678406 | + | 603 | CAR44841 | putative plasmid-related protein | - |
| PMI2452 | 2678515..2679189 | + | 675 | CAR44842 | endonuclease precursor | - |
| PMI2453 | 2679254..2679772 | - | 519 | CAR44843 | putative plasmid-related regulatory protein | - |
| PMI2454 | 2679792..2682065 | - | 2274 | CAR44844 | putative plasmid-related membrane protein | - |
| PMI2455 | 2682075..2682323 | - | 249 | CAR44846 | putative plasmid-related glycin-rich membrane protein | - |
| PMI2456 | 2682565..2686257 | - | 3693 | CAR44848 | putative mating pair stabilization protein | traN |
| PMI2457 | 2686260..2687288 | - | 1029 | CAR44850 | putative plasmid pilus assembly | traU |
| PMI2458 | 2687272..2688399 | - | 1128 | CAR44852 | putative plasmid pilus assembly protein | traW |
| PMI2459 | 2688407..2688919 | - | 513 | CAR44853 | putative plasmid conjugation signal peptidase | - |
| PMI2460 | 2688903..2689250 | - | 348 | CAR44855 | putative plasmid-related protein | - |
| PMI2461 | 2689243..2691642 | - | 2400 | CAR44856 | putative plasmid pilus assembly protein | virb4 |
| PMI2462 | 2691642..2692334 | - | 693 | CAR44859 | putative plasmid-related disulfide bond isomerase | trbB |
| PMI2463 | 2692466..2693404 | - | 939 | CAR44861 | putative plasmid-related protein | - |
| PMI2464 | 2693397..2694230 | - | 834 | CAR44862 | putative plasmid-related protein | - |
| PMI2465 | 2694408..2694794 | - | 387 | CAR44863 | putative plasmid-related protein | - |
| PMI2466 | 2694791..2695441 | - | 651 | CAR44865 | putative plasmid-related protein | traV |
| PMI2467 | 2695438..2696727 | - | 1290 | CAR44866 | putative plasmid pilus assembly protein | traB |
| PMI2468 | 2696730..2697629 | - | 900 | CAR44868 | putative plasmid-related protein | traK |
| PMI2469 | 2697610..2698236 | - | 627 | CAR44870 | putative plasmid pilus assembly protein | traE |
| PMI2470 | 2698233..2698514 | - | 282 | CAR44872 | putative plasmid pilus assembly protein | traL |
| PMI2471 | 2698550..2698789 | + | 240 | CAR44874 | putative plasmid-related protein | - |
| PMI2472 | 2698803..2699390 | + | 588 | CAR44878 | putative plasmid-related protein | - |
| PMI2473 | 2699417..2700061 | - | 645 | CAR44880 | putative plasmid-related protein | tfc7 |
| PMI2474 | 2700039..2700599 | - | 561 | CAR44881 | putative plasmid-related protein | - |
| PMI2475 | 2700609..2702429 | - | 1821 | CAR44883 | putative plasmid conjugative transfer protein | virb4 |
| PMI2476 | 2702478..2704628 | - | 2151 | CAR44884 | putative plasmid conjugative relaxase | - |
| PMI2477 | 2704877..2707012 | - | 2136 | CAR44885 | putative DNA helicase | - |
Host bacterium
| ID | 71 | Element type | |
| Element name | ICEPmiUSA1 | GenBank | AM942759 |
| Element size | 4063606 bp | Coordinate of oriT [Strand] | 2726938..2727236 [-] |
| Host bacterium | Proteus mirabilis strain HI4320 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |