Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200062
Name   oriT_ICEVchMZO3 in_silico
Organism   Vibrio cholerae MZO-3
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   NZ_AAUU01000001 (33643..33941 [+], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      178..192, 216..230  (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   _

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEVchMZO3
GCTCTGTTTGGCGGCGGATGACTGAGCCAAAAAAATCGAGACGCCAAACGTCGTTTGCATTATGGCCTGAACTCGCCAAACGGTTTGTATCATCATGACGATACGTCTTTTTAGGCGTTTTTAAGTGAAATCGGCCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Ceccarelli D et al. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PMID:18539733]


Host bacterium


ID   70 Element type   
Element name   ICEVchMZO3 GenBank   NZ_AAUU01000001
Element size   105212 bp Coordinate of oriT [Strand]   33643..33941 [+]
Host bacterium   Vibrio cholerae MZO-3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -