Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200061
Name   oriT_ICEVchB33 in_silico
Organism   Vibrio cholerae B33
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   NZ_AAWE01000040 (26285..26583 [+], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      178..192, 216..230  (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   _

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEVchB33
GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTTTTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Ceccarelli D et al. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PMID:18539733]


Host bacterium


ID   69 Element type   
Element name   ICEVchB33 (ICEVchMoz10) GenBank   NZ_AAWE01000040
Element size   29891 bp Coordinate of oriT [Strand]   26285..26583 [+]
Host bacterium   Vibrio cholerae B33

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -