Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200060
Name   oriT_ICEVchVie1 in_silico
Organism   Vibrio cholerae
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   AB114188 (2684..2982 [+], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      178..192, 216..230  (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   _

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEVchVie1
GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTTTTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Ceccarelli D et al. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PMID:18539733]


Host bacterium


ID   68 Element type   
Element name   ICEVchVie1 GenBank   AB114188
Element size   23402 bp Coordinate of oriT [Strand]   2684..2982 [+]
Host bacterium   Vibrio cholerae

Cargo genes


Drug resistance gene   floR, aph(6)-Id, tet(A), aph(3'')-Ib, sul2
Virulence gene   -
Metal resistance gene   merR
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -