Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   200059
Name   oriT_ICEPdaSpa1 experimental
Organism   Photobacterium damselae subsp. piscicida integrative and
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   AJ870986 (3520..3818 [+], 299 nt)
oriT length   299 nt
IRs (inverted repeats)      178..192, 216..230  (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site    		  _
Note   _

  oriT sequence  


Download         Length: 299 nt

>oriT_ICEPdaSpa1
GCTCTGTTTGGCGGCGGATGACCTAGTCAAAAAAATCGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTCGCCAAACGGTTTGTATCTTCATGACGATACGTCGTTTTAGGCGTTTTTAAGTGAAATCGGGCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]
[2] Ceccarelli D et al. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PMID:18539733]


T4SS

T4SS were predicted by using oriTfinder2.

Region 1: 41498..68784

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
Locus_31 39300..41450 + 2151 CAQ34962 TraI -
Locus_32 41498..43318 + 1821 CAQ34963 TraD virb4
Locus_33 43875..44510 + 636 CAQ34964 hypothetical protein tfc7
Locus_34 44537..45124 - 588 CAQ34965 hypothetical protein -
Locus_35 45138..45377 - 240 CAQ34966 hypothetical protein -
Locus_36 45413..45694 + 282 CAQ34967 TraL traL
Locus_37 45691..46317 + 627 CAQ34968 TraE traE
Locus_38 46298..47197 + 900 CAQ34969 hypothetical protein traK
Locus_39 47200..48489 + 1290 CAQ34970 TraB traB
Locus_40 48486..49136 + 651 CAQ34971 TraV traV
Locus_41 49133..49519 + 387 CAQ34972 TraA -
Locus_42 49697..50530 + 834 CAQ34973 hypothetical protein -
Locus_43 50523..51461 + 939 CAQ34974 hypothetical protein -
Locus_44 52041..54770 + 2730 CAQ34975 hypothetical protein -
Locus_45 54767..55876 + 1110 CAQ34976 hypothetical protein -
Locus_46 55889..57421 + 1533 CAQ34977 hypothetical protein -
Locus_47 57736..58869 + 1134 CAQ34978 hypothetical protein -
Locus_48 59015..59707 + 693 CAQ34979 hypothetical protein trbB
Locus_49 59707..62106 + 2400 CAQ34980 TraC virb4
Locus_50 62430..62942 + 513 CAQ34981 TrsF -
Locus_51 62893..64077 + 1185 CAQ34982 TraW traW
Locus_52 64061..65089 + 1029 CAQ34983 TraU traU
Locus_53 65092..68784 + 3693 CAI35915 TraN traN
Locus_54 68947..69474 - 528 CAQ34984 hypothetical protein -
Locus_55 69484..70257 - 774 CAQ34985 hypothetical protein -
Locus_56 70416..71018 - 603 CAQ34986 hypothetical protein -
Locus_57 71386..71712 + 327 CAQ34987 hypothetical protein -
Locus_58 71728..72147 + 420 CAQ34988 hypothetical protein -
Locus_59 72227..73045 + 819 CAQ34989 hypothetical protein -

Host bacterium

ID   67 Element type   
Element name   ICEPdaSpa1 GenBank   AJ870986
Element size   102985 bp Coordinate of oriT [Strand]   3520..3818 [+]
Host bacterium   Photobacterium damselae subsp. piscicida integrative and

Cargo genes

Drug resistance gene   tet(59)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -