Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 200058
• Name: oriT_ICESpuPO1
• Organism: Shewanella sp. W3-18-1
• Sequence Completeness: intact
• NCBI accession of oriT (coordinates [strand]): NC_008750 (1228915..1229213 [+], 299 nt)
• oriT length: 299 nt
• IRs (inverted repeats): 178..192, 216..230 (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT)
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: _

oriT sequence

• Length: 299 nt

>oriT_ICESpuPO1
GCGCTGTTTGGCGGCGGATGACTGAGCCAAAAAAATCGAGACGCCAAACGTCGTTTGCATTCTGGCCTGAACTCGCCAAACGGTTTGTATCTTCATGACGATACGTCTTTTTAGGCGTTTTTAAGTGAAATCGGGCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATCGAGACGCCAAACAGTGATTGTGACGGTAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGGTGAGGAAATTGGTTTGGTAGAAA

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Wozniak RA et al. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216]
[2] Ceccarelli D et al. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PMID:18539733]

Host bacterium

• ID: 66
• Element name: ICESpuPO1
• GenBank: NC_008750
• Element size: 4708380 bp
• Coordinate of oriT [Strand]: 1228915..1229213 [+]
• Host bacterium: Shewanella sp. W3-18-1

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -