Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200051
Name   oriT_Tn6084 in_silico
Organism   Enterococcus faecium C68 assembly_C68_1217
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   HM243622 (36637..36851 [+], 215 nt)
oriT length   215 nt
IRs (inverted repeats)      61..76, 80..95  (ACTTAACCCCCCGTAT..ACAGGGGGGTACAAAT)
  123..134, 139..150  (GAAAATCCTTTG..CAAGGGATTTAC)
Location of nic site      135..136
Conserved sequence flanking the
  nic site  
 
 TGG|T
Note   blastn alignment with the oriT_Tn916

  oriT sequence  


Download         Length: 215 nt

>oriT_Tn6084
AAGCGGAAGTCGCAGGTGTGGACTGATCTTGCTGGCTGGTGTGGCAATAGCCACGCCAGCACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATACGCCTTTTTGATTGGAGGGATTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   56 Element type   Transposon
Element name   Tn6084 GenBank   HM243622
Element size   74942 bp Coordinate of oriT [Strand]   36637..36851 [+]
Host bacterium   Enterococcus faecium C68 assembly_C68_1217 Coordinate of element   34197..56508

Cargo genes


Drug resistance gene   tet(M)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -