Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200043
Name   oriT_Tn6085b in_silico
Organism   Enterococcus faecium C68 assembly_C68_1782
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   HM243623 (15021..15235 [+], 215 nt)
oriT length   215 nt
IRs (inverted repeats)      61..76, 80..95  (ACTTAACCCCCCGTAT..ACAGGGGGGTACAAAT)
  123..134, 139..150  (GAAAATCCTTTG..CAAGGGATTTAC)
Location of nic site      135..136
Conserved sequence flanking the
  nic site  
 
 TGG|T
Note   blastn alignment with the oriT_Tn916

  oriT sequence  


Download         Length: 215 nt

>oriT_Tn6085b
AAGCGGAAGTCGCAGGTGTGGACTGATCTTGCTGGCTGGTGTGGCAATAGCCACGCCAGCACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATACGCCTTTTTGATTGGAGGGATTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   48 Element type   Transposon
Element name   Tn6085b GenBank   HM243623
Element size   37700 bp Coordinate of oriT [Strand]   15021..15235 [+]
Host bacterium   Enterococcus faecium C68 assembly_C68_1782 Coordinate of element   12581..33370

Cargo genes


Drug resistance gene   tet(M)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -