Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200034
Name   oriT_Tn925 in_silico
Organism   Enterococcus faecalis
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   AY855841 (55445..55659 [-], 215 nt)
oriT length   215 nt
IRs (inverted repeats)      61..76, 80..95  (ACTTAACCCCCCGTAT..ACAGGGGGGTACAAAT)
  123..134, 139..150  (GAAAATCCTTTG..CAAGGGATTTAC)
Location of nic site      135..136
Conserved sequence flanking the
  nic site  
 
 TGG|T
Note   blastn alignment with the oriT_Tn916

  oriT sequence  


Download         Length: 215 nt

>oriT_Tn925
AAGCGGAAGTCGCAGGTGTGGACTGATCTTGCTGGCTGGTGTGGCAATAGCCACGCCAGCACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATACGCCTTTTTGATTGGAGGGATTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   39 Element type   Transposon
Element name   Tn925 GenBank   AY855841
Element size   67673 bp Coordinate of oriT [Strand]   55445..55659 [-]
Host bacterium   Enterococcus faecalis Coordinate of element   40068..58099

Cargo genes


Drug resistance gene   tet(M)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -