Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200021 |
| Name | oriT_ICEKpnHS11286-1  |
| Organism | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | CP003200 (3479641..3479890 [+], 250 nt) |
| oriT length | 250 nt |
| IRs (inverted repeats) | 1..11, 158..168 (GCACACCGTCG.. CGACGGTGTGC) 57..75, 131..149 (GCGCGACCAACCCCTTTAA..TTAAAGGGGTTGGTCGCGC) |
| Location of nic site | 142..143 |
| Conserved sequence flanking the nic site |
GGTTG|GTCGCG |
| Note | blastn alignment with the oriT_ ICEKp1 |
oriT sequence
Download Length: 250 nt
>oriT_ICEKpnHS11286-1
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCGGCGGGGAATATGCCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCCGTTGACCCCGGGGGTTTTGACGCGACGTTCAGCCGCGACATTACCCCCATGCGACAGGCAATAAGGGCGTCCAGCCCG
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCGGCGGGGAATATGCCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCCGTTGACCCCGGGGGTTTTGACGCGACGTTCAGCCGCGACATTACCCCCATGCGACAGGCAATAAGGGCGTCCAGCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 3468340..3478265
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KPHS_34720 | 3464874..3465800 | + | 927 | AEW62170 | hypothetical protein | - |
| KPHS_34730 | 3466314..3466895 | + | 582 | AEW62171 | hypothetical protein | - |
| KPHS_34740 | 3467337..3467465 | + | 129 | AEW62172 | hypothetical protein | - |
| KPHS_34750 | 3468034..3468267 | + | 234 | AEW62173 | hypothetical protein | - |
| KPHS_34760 | 3468340..3469050 | + | 711 | AEW62174 | putative type IV secretory pathway VirB1 component | virB1 |
| KPHS_34770 | 3469164..3469343 | + | 180 | AEW62175 | hypothetical protein | virB2 |
| KPHS_34780 | 3469356..3472094 | + | 2739 | AEW62176 | putative type IV secretory pathway VirB4 component | virb4 |
| KPHS_34790 | 3472112..3472819 | + | 708 | AEW62177 | hypothetical protein | - |
| KPHS_34800 | 3473073..3474146 | + | 1074 | AEW62178 | hypothetical protein | virB6 |
| KPHS_34810 | 3474219..3474338 | - | 120 | AEW62179 | hypothetical protein | - |
| KPHS_34820 | 3474368..3475051 | + | 684 | AEW62180 | type IV secretion system VirB8 component | virB8 |
| KPHS_34830 | 3475048..3475956 | + | 909 | AEW62181 | type IV secretory pathway VirB9 component | virB9 |
| KPHS_34840 | 3476000..3477250 | + | 1251 | AEW62182 | type IV secretory pathway VirB10 component | virB10 |
| KPHS_34850 | 3477240..3478265 | + | 1026 | AEW62183 | type IV secretory pathway VirB11 component | virB11 |
| KPHS_34860 | 3479193..3479348 | + | 156 | AEW62184 | hypothetical protein | - |
| KPHS_34870 | 3480058..3481917 | + | 1860 | AEW62185 | putative MobB mobilization protein | - |
| KPHS_34880 | 3481927..3482673 | + | 747 | AEW62186 | putative MobC mobilization protein | - |
Host bacterium
| ID | 26 | Element type | |
| Element name | ICEKpnHS11286-1 | GenBank | CP003200 |
| Element size | 5333942 bp | Coordinate of oriT [Strand] | 3479641..3479890 [+] |
| Host bacterium | Klebsiella pneumoniae subsp. pneumoniae HS11286 | Coordinate of element | 3433546..3495775 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | ybtS, ybtX, ybtQ, ybtP, ybtA, irp2, irp1, ybtU, ybtT, ybtE, fyuA |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |