Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200020
Name   oriT_HPI-ICEEh1 in_silico
Organism   Enterobacter hormaechei recombination hotspot with five
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   FN297818 (88506..88755 [+], 250 nt)
oriT length   250 nt
IRs (inverted repeats)      1..11, 158..168  (GCACACCGTCG..CGACGGTGTGC)
  57..75, 131..149  (GCGCGACCACCCCCTTTAA..TTAAAGGGGGTGGTCGCGC)
Location of nic site      142..143
Conserved sequence flanking the
  nic site  
 
 GGGTG|GTCGCG
Note   blastn alignment with the oriT_ ICEKp1

  oriT sequence  


Download         Length: 250 nt

>oriT_HPI-ICEEh1
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCGGCGGGGAATATGCCGATTAGGCGCGACCACCCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGGTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCCTTTGACCCTGGGGGTTTTGGCGTGGCGTCCAGCCGCGACATTACCCCCATGCGACAGGCAATAAGGGCGTCCAGCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


T4SS


T4SS were predicted by using oriTfinder2.

Region 1: 77213..87138

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
Locus_45 73747..74673 + 927 CAX65497 hypothetical protein -
Locus_46 75187..75768 + 582 CAX65498 hypothetical protein -
Locus_47 76905..77189 - 285 CAX65499 hypothetical protein -
Locus_48 77213..77923 + 711 CAX65500 putative Pilx1/VirB1-like protein virB1
Locus_49 77923..78216 + 294 CAX65501 putative VirB2-like protein virB2
Locus_50 78229..80967 + 2739 CAX65502 putative Pilx3-4/VirB3-4-like protein virb4
Locus_51 80985..81692 + 708 CAX65503 putative Pilx5/VirB5-like protein -
Locus_52 81700..81942 + 243 CAX65504 hypothetical protein -
Locus_53 81946..83019 + 1074 CAX65505 putative Pilx6/VirB6-like protein virB6
Locus_54 83111..83248 + 138 CAX65506 hypothetical protein -
Locus_55 83241..83924 + 684 CAX65507 putative PilX8-VirB8-like protein virB8
Locus_56 83921..84829 + 909 CAX65508 putative Pilx9/VirB9-like protein virB9
Locus_57 84873..86123 + 1251 CAX65509 putative Pilx10/VirB10-like protein virB10
Locus_58 86113..87138 + 1026 CAX65510 putative Pilx11/VirB11-like protein virB11
Locus_59 87135..87533 + 399 CAX65511 hypothetical protein -
Locus_60 87569..87874 + 306 CAX65512 YggA-like protein -
Locus_61 87908..88213 + 306 CAX65513 hypothetical protein -
Locus_62 88324..88626 + 303 CAX65514 hypothetical protein -
Locus_63 88893..90782 + 1890 CAX65515 putative MobB-like protein -
Locus_64 90792..91538 + 747 CAX65516 MobC-like protein -


Host bacterium


ID   25 Element type   
Element name   HPI-ICEEh1 GenBank   FN297818
Element size   140338 bp Coordinate of oriT [Strand]   88506..88755 [+]
Host bacterium   Enterobacter hormaechei recombination hotspot with five Coordinate of element   42411..108644

Cargo genes


Drug resistance gene   -
Virulence gene   ybtS, ybtX, ybtQ, ybtP, ybtA, irp2, irp1, ybtU, ybtT, ybtE, fyuA
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -