Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200018 |
| Name | oriT_ICECkoBAA-1 |
| Organism | Citrobacter koseri ATCC BAA-895 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | CP000822 (872891..873140 [+], 250 nt) |
| oriT length | 250 nt |
| IRs (inverted repeats) | 1..11, 158..168 (GCACACCGTCG.. CGACGGTGTGC) 57..75, 131..149 (GCGCGACCAACCCCTTTAA..TTAAAGGGGTTGGTCGCGC) |
| Location of nic site | 142..143 |
| Conserved sequence flanking the nic site |
GGTTG|GTCGCG |
| Note | blastn alignment with the oriT_ ICEKp1 |
oriT sequence
Download Length: 250 nt
>oriT_ICECkoBAA-1
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCAGCGGGGAATATGCCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGCGCGACGGTGTGCCGCCTTTGACCCTGGGGGTTTTGGTCCGGCGTCCAGCCGGGACATTACCCCCATGTGCCATGCAGTGAGGGCGTCCAGCCCG
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCAGCGGGGAATATGCCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGCGCGACGGTGTGCCGCCTTTGACCCTGGGGGTTTTGGTCCGGCGTCCAGCCGGGACATTACCCCCATGTGCCATGCAGTGAGGGCGTCCAGCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 870917..884763
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CKO_00875 | 866152..867612 | + | 1461 | ABV12025 | hypothetical protein | - |
| CKO_00876 | 867758..868327 | + | 570 | ABV12026 | hypothetical protein | - |
| CKO_00877 | 868362..868874 | + | 513 | ABV12027 | hypothetical protein | - |
| CKO_00878 | 869101..869256 | + | 156 | ABV12028 | hypothetical protein | - |
| CKO_00879 | 870144..870908 | - | 765 | ABV12029 | hypothetical protein | - |
| CKO_00880 | 870917..872671 | - | 1755 | ABV12030 | hypothetical protein | virb4 |
| CKO_00881 | 872747..873001 | - | 255 | ABV12031 | hypothetical protein | - |
| CKO_00882 | 873294..873581 | + | 288 | ABV12032 | hypothetical protein | - |
| CKO_00883 | 873434..873739 | - | 306 | ABV12033 | hypothetical protein | - |
| CKO_00884 | 873782..874150 | - | 369 | ABV12034 | hypothetical protein | - |
| CKO_00885 | 874117..874515 | - | 399 | ABV12035 | hypothetical protein | - |
| CKO_00886 | 874512..875537 | - | 1026 | ABV12036 | hypothetical protein | virB11 |
| CKO_00888 | 875527..875847 | - | 321 | ABV12038 | hypothetical protein | - |
| CKO_00887 | 875696..875869 | + | 174 | ABV12037 | hypothetical protein | - |
| CKO_00889 | 875859..877103 | - | 1245 | ABV12039 | hypothetical protein | virB10 |
| CKO_00890 | 877147..878055 | - | 909 | ABV12040 | hypothetical protein | virB9 |
| CKO_00891 | 878052..878735 | - | 684 | ABV12041 | hypothetical protein | virB8 |
| CKO_00892 | 878728..878880 | - | 153 | ABV12042 | hypothetical protein | - |
| CKO_00893 | 878957..880030 | - | 1074 | ABV12043 | hypothetical protein | virB6 |
| CKO_00894 | 880034..880276 | - | 243 | ABV12044 | hypothetical protein | - |
| CKO_00895 | 880284..880991 | - | 708 | ABV12045 | hypothetical protein | - |
| CKO_00896 | 881009..883747 | - | 2739 | ABV12046 | hypothetical protein | virb4 |
| CKO_00897 | 883760..884053 | - | 294 | ABV12047 | hypothetical protein | virB2 |
| CKO_00898 | 884053..884763 | - | 711 | ABV12048 | hypothetical protein | virB1 |
| CKO_00899 | 884836..885069 | - | 234 | ABV12049 | hypothetical protein | - |
| CKO_00900 | 885330..885470 | + | 141 | ABV12050 | hypothetical protein | - |
| CKO_00901 | 885638..885766 | - | 129 | ABV12051 | hypothetical protein | - |
| CKO_00902 | 886208..886789 | - | 582 | ABV12052 | hypothetical protein | - |
| CKO_00903 | 886978..887163 | - | 186 | ABV12053 | hypothetical protein | - |
| CKO_00904 | 887303..888229 | - | 927 | ABV12054 | hypothetical protein | - |
Host bacterium
| ID | 23 | Element type | |
| Element name | ICECkoBAA-1 | GenBank | CP000822 |
| Element size | 4720462 bp | Coordinate of oriT [Strand] | 872891..873140 [+] |
| Host bacterium | Citrobacter koseri ATCC BAA-895 | Coordinate of element | 816173..919555 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | clbA, clbB, clbC, clbD, clbE, clbF, clbG, clbH, clbI, clbJ, clbK, clbL, clbM, clbN, clbO, clbP, clbQ, clbS, fyuA, ybtE, ybtT, ybtU, irp1, irp2, ybtA, ybtP, ybtQ, ybtX, ybtS |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |