Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200017 |
| Name | oriT_ICEEcoED1a-1 |
| Organism | Escherichia coli ED1a |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | CU928162 (2210225..2210474 [+], 250 nt) |
| oriT length | 250 nt |
| IRs (inverted repeats) | 1..11, 158..168 (GCACACCGTCG.. CGACGGTGTGC) 57..75, 131..149 (GCGCGACCAACCCCTTTAA..TTAAAGGGGTTGGTCGCGC) |
| Location of nic site | 142..143 |
| Conserved sequence flanking the nic site |
GGTTG|GTCGCG |
| Note | blastn alignment with the oriT_ ICEKp1 |
oriT sequence
Download Length: 250 nt
>oriT_ICEEcoED1a-1
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCGGCGGGGAATATGCCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCCTTTGACCCTGGGGGTTTTGGCGTGGCGTCCAGCCGCGACATTACCCCCATGCGACAGGCAATAAGGGCGTCCAGCCCG
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCGGCGGGGAATATGCCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCCTTTGACCCTGGGGGTTTTGGCGTGGCGTCCAGCCGCGACATTACCCCCATGCGACAGGCAATAAGGGCGTCCAGCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 2198922..2208857
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ECED1_2255 | 2195417..2196400 | + | 984 | CAR08442 | conserved hypothetical protein | - |
| ECED1_2256 | 2196744..2196929 | + | 186 | CAR08443 | conserved hypothetical protein | - |
| ECED1_2257 | 2196914..2197495 | + | 582 | CAR08444 | conserved hypothetical protein | - |
| ECED1_2258 | 2197485..2197694 | + | 210 | CAR08445 | putative lambdoid prophage protein from the DksA/TraR family with a zinc finger | - |
| ECED1_2259 | 2197937..2198065 | + | 129 | CAR08324 | conserved hypothetical protein | - |
| ECED1_2260 | 2198634..2198867 | + | 234 | CAR08325 | conserved hypothetical protein | - |
| ECED1_2261 | 2198922..2199650 | + | 729 | CAR08448 | putative type IV secretory pathway VirB1 component | virB1 |
| ECED1_2262 | 2199650..2199943 | + | 294 | CAR08449 | putative type IV secretory pathway VirB2 component | virB2 |
| ECED1_2263 | 2199956..2202694 | + | 2739 | CAR08450 | putative type IV secretory pathway VirB4 component | virb4 |
| ECED1_2264 | 2202712..2203419 | + | 708 | CAR08329 | putative type IV secretory pathway VirB5 component | - |
| ECED1_2265 | 2203427..2203669 | + | 243 | CAR08452 | conserved hypothetical protein; putative exported protein | - |
| ECED1_2266 | 2203673..2204746 | + | 1074 | CAR08453 | putative type IV secretory pathway VirB6 component | virB6 |
| ECED1_2267 | 2204968..2205651 | + | 684 | CAR08454 | putative type IV secretory pathway VirB8 component | virB8 |
| ECED1_2268 | 2205648..2206556 | + | 909 | CAR08455 | putative type IV secretory pathway VirB9 component | virB9 |
| ECED1_2269 | 2206586..2207842 | + | 1257 | CAR08456 | putative type IV secretory pathway VirB10 component | virB10 |
| ECED1_2270 | 2207832..2208857 | + | 1026 | CAR08457 | putative type IV secretory pathway VirB11 component | virB11 |
| ECED1_2271 | 2208854..2209252 | + | 399 | CAR08458 | conserved hypothetical protein; putative exported protein | - |
| ECED1_2272 | 2209288..2209593 | + | 306 | CAR08459 | putative plasmid conjugation protein | - |
| ECED1_2273 | 2209627..2209932 | + | 306 | CAR08460 | conserved hypothetical protein | - |
| ECED1_2274 | 2210612..2212501 | + | 1890 | CAR08461 | putative MobB mobilization protein | - |
| ECED1_2275 | 2212511..2213257 | + | 747 | CAR08340 | putative MobC mobilization protein | - |
Host bacterium
| ID | 22 | Element type | |
| Element name | ICEEcoED1a-1 | GenBank | CU928162 |
| Element size | 5209548 bp | Coordinate of oriT [Strand] | 2210225..2210474 [+] |
| Host bacterium | Escherichia coli ED1a | Coordinate of element | 2164157..2222338 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | ybtS, ybtX, ybtQ, ybtP, ybtA, irp2, irp1, ybtU, ybtT, ybtE, fyuA |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |