Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   200017
Name   oriT_ICEEcoED1a-1 in_silico
Organism   Escherichia coli ED1a
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   CU928162 (2210225..2210474 [+], 250 nt)
oriT length   250 nt
IRs (inverted repeats)      1..11, 158..168  (GCACACCGTCG.. CGACGGTGTGC)
  57..75, 131..149  (GCGCGACCAACCCCTTTAA..TTAAAGGGGTTGGTCGCGC)
Location of nic site      142..143
Conserved sequence flanking the
  nic site    		  GGTTG|GTCGCG
Note   blastn alignment with the oriT_ ICEKp1

  oriT sequence  


Download         Length: 250 nt

>oriT_ICEEcoED1a-1
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCGGCGGGGAATATGCCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCCTTTGACCCTGGGGGTTTTGGCGTGGCGTCCAGCCGCGACATTACCCCCATGCGACAGGCAATAAGGGCGTCCAGCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


T4SS

T4SS were predicted by using oriTfinder2.

Region 1: 2198922..2208857

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
ECED1_2255 2195417..2196400 + 984 CAR08442 conserved hypothetical protein -
ECED1_2256 2196744..2196929 + 186 CAR08443 conserved hypothetical protein -
ECED1_2257 2196914..2197495 + 582 CAR08444 conserved hypothetical protein -
ECED1_2258 2197485..2197694 + 210 CAR08445 putative lambdoid prophage protein from the DksA/TraR family with a zinc finger -
ECED1_2259 2197937..2198065 + 129 CAR08324 conserved hypothetical protein -
ECED1_2260 2198634..2198867 + 234 CAR08325 conserved hypothetical protein -
ECED1_2261 2198922..2199650 + 729 CAR08448 putative type IV secretory pathway VirB1 component virB1
ECED1_2262 2199650..2199943 + 294 CAR08449 putative type IV secretory pathway VirB2 component virB2
ECED1_2263 2199956..2202694 + 2739 CAR08450 putative type IV secretory pathway VirB4 component virb4
ECED1_2264 2202712..2203419 + 708 CAR08329 putative type IV secretory pathway VirB5 component -
ECED1_2265 2203427..2203669 + 243 CAR08452 conserved hypothetical protein; putative exported protein -
ECED1_2266 2203673..2204746 + 1074 CAR08453 putative type IV secretory pathway VirB6 component virB6
ECED1_2267 2204968..2205651 + 684 CAR08454 putative type IV secretory pathway VirB8 component virB8
ECED1_2268 2205648..2206556 + 909 CAR08455 putative type IV secretory pathway VirB9 component virB9
ECED1_2269 2206586..2207842 + 1257 CAR08456 putative type IV secretory pathway VirB10 component virB10
ECED1_2270 2207832..2208857 + 1026 CAR08457 putative type IV secretory pathway VirB11 component virB11
ECED1_2271 2208854..2209252 + 399 CAR08458 conserved hypothetical protein; putative exported protein -
ECED1_2272 2209288..2209593 + 306 CAR08459 putative plasmid conjugation protein -
ECED1_2273 2209627..2209932 + 306 CAR08460 conserved hypothetical protein -
ECED1_2274 2210612..2212501 + 1890 CAR08461 putative MobB mobilization protein -
ECED1_2275 2212511..2213257 + 747 CAR08340 putative MobC mobilization protein -

Host bacterium

ID   22 Element type   
Element name   ICEEcoED1a-1 GenBank   CU928162
Element size   5209548 bp Coordinate of oriT [Strand]   2210225..2210474 [+]
Host bacterium   Escherichia coli ED1a Coordinate of element   2164157..2222338

Cargo genes

Drug resistance gene   -
Virulence gene   ybtS, ybtX, ybtQ, ybtP, ybtA, irp2, irp1, ybtU, ybtT, ybtE, fyuA
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -