Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200016 |
| Name | oriT_ICEDdaEch586-1  |
| Organism | Dickeya parazeae Ech586 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | CP001836 (3010140..3010386 [+], 247 nt) |
| oriT length | 247 nt |
| IRs (inverted repeats) | 1..10, 158..167 (GCACACCGTC..GACGGTGTGC) 57..75, 130..148 (GCGCGACCAACCCCTTTAA..TTAAAGGGGTTGGTCGCGC) |
| Location of nic site | 141..142 |
| Conserved sequence flanking the nic site |
GGTTG|GTCGCG |
| Note | blastn alignment with the oriT_ ICEKp1 |
oriT sequence
Download Length: 247 nt
>oriT_ICEDdaEch586-1
GCACACCGTCAAGCCAGGTGATATTTCCCGCCCCAGCGGGGAATATCACCGATCAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCGTTTTTTGGAGCTTGCGAGAAAAAACAGGCGAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGGGCGACGGTGTGCCGCCGTTGACGTTGGGGGTTTTGGCGCGGCGTCCAGCCGGAACATTACCCCCATGTGACATTACATAAGGGCGTCCAGCC
GCACACCGTCAAGCCAGGTGATATTTCCCGCCCCAGCGGGGAATATCACCGATCAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCGTTTTTTGGAGCTTGCGAGAAAAAACAGGCGAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGGGCGACGGTGTGCCGCCGTTGACGTTGGGGGTTTTGGCGCGGCGTCCAGCCGGAACATTACCCCCATGTGACATTACATAAGGGCGTCCAGCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 2997519..3012415
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| Dd586_2657 | 2992682..2993596 | + | 915 | ACZ77499 | conserved hypothetical protein | - |
| Dd586_2658 | 2993749..2993943 | + | 195 | ACZ77500 | phage transcriptional regulator, AlpA | - |
| Dd586_2659 | 2993958..2994542 | + | 585 | ACZ77501 | conserved hypothetical protein | - |
| Dd586_2660 | 2994532..2994735 | + | 204 | ACZ77502 | transcriptional regulator, TraR/DksA family | - |
| Dd586_2661 | 2994911..2995762 | - | 852 | ACZ77503 | transcriptional regulator, LysR family | - |
| Dd586_2662 | 2995862..2996725 | + | 864 | ACZ77504 | protein of unknown function DUF6 transmembrane | - |
| Dd586_2663 | 2997209..2997442 | + | 234 | ACZ77505 | conserved hypothetical protein | - |
| Dd586_2664 | 2997519..2998226 | + | 708 | ACZ77506 | Lytic transglycosylase catalytic | virB1 |
| Dd586_2665 | 2998226..2998519 | + | 294 | ACZ77507 | Conjugal transfer protein TrbC | virB2 |
| Dd586_2666 | 2998530..3001274 | + | 2745 | ACZ77508 | CagE, TrbE, VirB component of type IV transporter system, conserved region | virb4 |
| Dd586_2667 | 3001295..3001999 | + | 705 | ACZ77509 | type IV secretion system family protein | - |
| Dd586_2668 | 3002011..3002235 | + | 225 | ACZ77510 | conserved hypothetical protein | - |
| Dd586_2669 | 3002246..3003310 | + | 1065 | ACZ77511 | TrbL/VirB6 plasmid conjugal transfer protein | virB6 |
| Dd586_2670 | 3003394..3003531 | + | 138 | ACZ77512 | conserved hypothetical protein | - |
| Dd586_2671 | 3003524..3004207 | + | 684 | ACZ77513 | VirB8 family protein | virB8 |
| Dd586_2672 | 3004207..3005112 | + | 906 | ACZ77514 | P-type conjugative transfer protein VirB9 | virB9 |
| Dd586_2673 | 3005132..3006373 | + | 1242 | ACZ77515 | conjugation TrbI family protein | virB10 |
| Dd586_2674 | 3006366..3006752 | + | 387 | ACZ77516 | hypothetical protein | - |
| Dd586_2675 | 3006683..3007690 | - | 1008 | ACZ77517 | conserved hypothetical protein | - |
| Dd586_2676 | 3007728..3008747 | + | 1020 | ACZ77518 | P-type DNA transfer ATPase VirB11 | virB11 |
| Dd586_2677 | 3008744..3009142 | + | 399 | ACZ77519 | conserved hypothetical protein | - |
| Dd586_2678 | 3009188..3009490 | + | 303 | ACZ77520 | KikA from plasmid origin; putative exported protein | - |
| Dd586_2679 | 3009540..3009845 | + | 306 | ACZ77521 | conserved hypothetical protein | - |
| Dd586_2681 | 3010556..3012415 | + | 1860 | ACZ77522 | putative MobB mobilization protein | virb4 |
| Dd586_2682 | 3012425..3013171 | + | 747 | ACZ77523 | mobilization protein | - |
| Dd586_2683 | 3013367..3014314 | - | 948 | ACZ77524 | domain of unknown function DUF1738 | - |
| Dd586_2684 | 3014599..3016797 | - | 2199 | ACZ77525 | helicase domain protein | - |
Host bacterium
| ID | 21 | Element type | |
| Element name | ICEDdaEch586-1 | GenBank | CP001836 |
| Element size | 4818394 bp | Coordinate of oriT [Strand] | 3010140..3010386 [+] |
| Host bacterium | Dickeya parazeae Ech586 | Coordinate of element | 2972027..3023093 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |