Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200013
Name   oriT_ICEKp1 experimental
Organism   Klebsiella pneumoniae
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   AB298504 (66386..66635 [+], 250 nt)
oriT length   250 nt
IRs (inverted repeats)      1..11, 158..168  (GCACACCGTCG.. CGACGGTGTGC)
  57..75, 131..149  (GCGCGACCAACCCCTTTAA..TTAAAGGGGTTGGTCGCGC)
Location of nic site      142..143
Conserved sequence flanking the
  nic site  
 
 GGTTG|GTCGCG
Note   _

  oriT sequence  


Download         Length: 250 nt

>oriT_ICEKp1
GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCGGCGGGGAATATGCCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGGACGACGGTGTGCCGCCTTTGACCCTGGGGGTTTTGGCGTGGCGTCCAGCCGCGACATTACCCCCATGCACCGGGCAATAAGGGCGTCCAGCCCG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Lin TL et al. (2008) Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess. J Bacteriol. 190(2):515-26. [PMID:17981959]


Host bacterium


ID   18 Element type   
Element name   ICEKp1 GenBank   AB298504
Element size   79281 bp Coordinate of oriT [Strand]   66386..66635 [+]
Host bacterium   Klebsiella pneumoniae

Cargo genes


Drug resistance gene   -
Virulence gene   ybtS, ybtX, ybtQ, ybtP, ybtA, irp2, irp1, ybtU, ybtT, ybtE, fyuA, iroN, iroB, iroC, iroD, rmpA
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -