Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200005 |
| Name | oriT_Tn6086  |
| Organism | Enterococcus faecium strain TC 6 |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | HM636636 (7493..7515 [+], 23 nt) |
| oriT length | 23 nt |
| IRs (inverted repeats) | 2..7, 17..22 (CCCCCT..AGGGGG) |
| Location of nic site | 13..14 |
| Conserved sequence flanking the nic site |
_ |
| Note | similar to oriT/nicK recognition site of ICEBs1 |
oriT sequence
Download Length: 23 nt
>oriT_Tn6086
GCCCCCTCTATCTAACAGGGGGG
GCCCCCTCTATCTAACAGGGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10 | Element type | ICE (Integrative and conjugative element) |
| Element name | Tn6086 | GenBank | HM636636 |
| Element size | 24468 bp | Coordinate of oriT [Strand] | 7493..7515 [+] |
| Host bacterium | Enterococcus faecium strain TC 6 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |