Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 200004 |
Name | oriT_ICESt1 |
Organism | Streptococcus thermophilus site-specific integrative |
Sequence Completeness | intact |
NCBI accession of oriT (coordinates [strand]) | AJ278471 (24659..24871 [+], 213 nt) |
oriT length | 213 nt |
IRs (inverted repeats) | 1..8, 12..19 (GCCTGACC..GGTCAGGC) 61..67, 80..86 ( AACCCCC..GGGGGTT) 154..159, 163..168 ( AAAGTG..CACTTT) 177..181, 185..189 ( AAGTG..CACTT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | _ |
oriT sequence
Download Length: 213 nt
>oriT_ICESt1
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAAACTTCAACCCCCGTTTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCATGA
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAAACTTCAACCCCCGTTTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCATGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileReference
[1] Pavlovic G et al. (2004) Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PMID:15073287]
Host bacterium
ID | 9 | Element type | ICE (Integrative and conjugative element) |
Element name | ICESt1 | GenBank | AJ278471 |
Element size | 36272 bp | Coordinate of oriT [Strand] | 24659..24871 [+] |
Host bacterium | Streptococcus thermophilus site-specific integrative |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |