Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200004
Name   oriT_ICESt1 in_silico
Organism   Streptococcus thermophilus site-specific integrative
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   AJ278471 (24659..24871 [+], 213 nt)
oriT length   213 nt
IRs (inverted repeats)      1..8, 12..19  (GCCTGACC..GGTCAGGC)
  61..67, 80..86  ( AACCCCC..GGGGGTT)
  154..159, 163..168  ( AAAGTG..CACTTT)
  177..181, 185..189  ( AAGTG..CACTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   _

  oriT sequence  


Download         Length: 213 nt

>oriT_ICESt1
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAAACTTCAACCCCCGTTTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCATGA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Pavlovic G et al. (2004) Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PMID:15073287]


Host bacterium


ID   9 Element type   ICE (Integrative and conjugative element)
Element name   ICESt1 GenBank   AJ278471
Element size   36272 bp Coordinate of oriT [Strand]   24659..24871 [+]
Host bacterium   Streptococcus thermophilus site-specific integrative

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -