Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122593 |
| Name | oriT1_ColpHAD28  |
| Organism | Enterobacter hormaechei subsp. xiangfangensis strain BT844:NRCR7 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAGYUY010000068 (72..128 [+], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT1_ColpHAD28
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 23019 | GenBank | NZ_JAGYUY010000068 |
| Plasmid name | ColpHAD28 | Incompatibility group | Col440I |
| Plasmid size | 2045 bp | Coordinate of oriT [Strand] | 72..128 [+]; 1990..2045 [+] |
| Host baterium | Enterobacter hormaechei subsp. xiangfangensis strain BT844:NRCR7 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |